Project description:Small interfering RNAs (siRNAs) targeting ZC3H18 were purchased from Suzhou Hongxun Biotechnology Co., Ltd. (Suzhou, China), with an empty vector serving as the control (si-nc). ZC3H18 siRNA sequences were GGGGTGAGGGCTTCTGATCT and TCGTCGGAGTGATTATCTTCCT. These siRNAs were introduced into KYSE150 and ECA109 cells using DharmaFect1 (Suzhou Hongxun Biotechnology Co., Ltd., Suzhou, China).
Project description:We compared the global transcriptomic analysis of Desulfoluna spongiiphila strain AA1, an organohalide-respiring Desulfobacterota isolated from a marine sponge, with 2,6-dibromophenol or with sulfate as electron acceptor. The most significant difference of the transcriptomic analysis was the expression of one reductive dehalogenase gene cluster (rdh16), which was significantly upregulated with 2,6-dibromophenol.
Project description:The purpose of this experiment is to investigate the chemical composition of the plant, with the plant samples collected in Hainan, China.
Project description:Transcriptomic and proteomic response of the organohalide respiring bacterium Desulfoluna spongiiphila to growth with bromophenol as electron acceptor
Project description:Organohalide-respiring Dehalococcoidia bacteria are one of the few microorganisms capable of transforming chlorinated solvents to benign ethene in anoxic environments. The tceA gene found in these bacteria, coding the trichloroethene-dechlorinating RDase TceA, is frequently detected in contaminated groundwater but not recognized as a biomarker for vinyl chloride detoxification. Here, we demonstrate that the tceA-carrying Dehalococcoides mccartyi (Dhc) strains FL2 and 195 grow with VC as electron acceptor when sufficient vitamin B12 is provided. Global proteomic profiling confirmed the predominant TceA expression in VC-grown Dhc FL2 cells, providing a line of evidence for the implication of TceA in respiratory VC reductive dechlorination.
Project description:We found that estrogen cell signaling played a regulatory role in MM bone disease (MMBD), and the estrogen-responsive gene microtubule-associated serine/threonine kinase family member 4 (MAST4) was a critical factor. To determine what signalling pathways are affected by MAST4 in MM cells, we established CTR-KD and MAST4-KD ARD MM cell lines. Total RNA of each sample was extracted using TRIzol Reagent (Invitrogen). Next generation sequencing library preparations were constructed using NEBNext® Ultra™ RNA Library Prep Kit for Illumina (Vazyme, Cat No. NR603, China).RNA-seq was performed by GENEWIZ (Suzhou, China) on an Illumina Hiseq platform.