Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Isolation of organohalide respiring bacteria in groundwater collected near a chemical plant in Suzhou, China.

PROVIDER: PRJNA1051306 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other
	SRR27276544_subreads.fastq.gz	Fastqsanger.gz
	SRR27271395_1.fastq.gz	Fastqsanger.gz
	SRR27271395_2.fastq.gz	Fastqsanger.gz

Items per page:

1 - 4 of 4

Similar Datasets

RNA-seq analysis of differentially expressed genes between WT and KD ZC3H18 KYSE150/ECA109 cells.

Project description:Small interfering RNAs (siRNAs) targeting ZC3H18 were purchased from Suzhou Hongxun Biotechnology Co., Ltd. (Suzhou, China), with an empty vector serving as the control (si-nc). ZC3H18 siRNA sequences were GGGGTGAGGGCTTCTGATCT and TCGTCGGAGTGATTATCTTCCT. These siRNAs were introduced into KYSE150 and ECA109 cells using DharmaFect1 (Suzhou Hongxun Biotechnology Co., Ltd., Suzhou, China).

2025-02-21 | GSE290209 | GEO

Transcriptomic and proteomic response of the organohalide respiring bacterium Desulfoluna spongiiphila to growth with 2,6-dibromophenol as electron acceptor

Project description:We compared the global transcriptomic analysis of Desulfoluna spongiiphila strain AA1, an organohalide-respiring Desulfobacterota isolated from a marine sponge, with 2,6-dibromophenol or with sulfate as electron acceptor. The most significant difference of the transcriptomic analysis was the expression of one reductive dehalogenase gene cluster (rdh16), which was significantly upregulated with 2,6-dibromophenol.

2020-01-10 | GSE141466 | GEO

sediment metagenome

Project description:Enrichment of organohalide respiring bacteria

| PRJNA349488 | ENA

Ferrimonas strain:YFM

Project description:Organohalide respiring bacterium capable of aerobic growth

| PRJDB15304 | ENA

Desulfoluna protein expression analysis

Project description:Transcriptomic and proteomic response of the organohalide respiring bacterium Desulfoluna spongiiphila to growth with bromophenol as electron acceptor

2020-01-07 | PXD016590 | Pride

Respiratory vinyl chloride reductive dechlorination to ethene in TceA-expressing Dehalococcoides mccartyi

Project description:Organohalide-respiring Dehalococcoidia bacteria are one of the few microorganisms capable of transforming chlorinated solvents to benign ethene in anoxic environments. The tceA gene found in these bacteria, coding the trichloroethene-dechlorinating RDase TceA, is frequently detected in contaminated groundwater but not recognized as a biomarker for vinyl chloride detoxification. Here, we demonstrate that the tceA-carrying Dehalococcoides mccartyi (Dhc) strains FL2 and 195 grow with VC as electron acceptor when sufficient vitamin B12 is provided. Global proteomic profiling confirmed the predominant TceA expression in VC-grown Dhc FL2 cells, providing a line of evidence for the implication of TceA in respiratory VC reductive dechlorination.

2020-10-09 | MSV000086254 | MassIVE

Expression data from control-knockdown (CTR-KD) and MAST4-KD human multiple myeloma (MM) cell lines

Project description:We found that estrogen cell signaling played a regulatory role in MM bone disease (MMBD), and the estrogen-responsive gene microtubule-associated serine/threonine kinase family member 4 (MAST4) was a critical factor. To determine what signalling pathways are affected by MAST4 in MM cells, we established CTR-KD and MAST4-KD ARD MM cell lines. Total RNA of each sample was extracted using TRIzol Reagent (Invitrogen). Next generation sequencing library preparations were constructed using NEBNext® Ultra™ RNA Library Prep Kit for Illumina (Vazyme, Cat No. NR603, China).RNA-seq was performed by GENEWIZ (Suzhou, China) on an Illumina Hiseq platform.

2024-07-03 | GSE179453 | GEO

RNA-seq of mouse myeloma cell line SP 2/0 overexpressed with Gm614 against vector control

Project description:We found that a novel gene Gm614 mRNA significantly changed in plasma cells. Because of plasmablast-like, Mus musculus myeloma SP 2/0 cell line was selected to test the effect of Gm614 overexpression on plasmablast/plasma cells. Gm614 cDNA (General Biosystems, Anhui, China) was cloned into lentiviral vector LV201 (Fugene Corp., Guangzhou, China) to generate Gm614 protein. Gm614-expressing LV201 was then transfected into SP 2/0 cells, and stable transfectants were identified by drug selection (Puromycin, Sigma, 10 μg/ml). To identify the effect of Gm614 overexpression on gene expression, we determined mRNA profiles in Gm614-overexpressed and vector-transduced SP 2/0 cells by RNA-seq. RNA-seq was done with an Illumina HiSeq 2500 instrument at GENEWIZ, Suzhou, China.

2020-08-10 | E-MTAB-7135 | biostudies-arrayexpress

meta- genomics and transcriptomic analyses of microbial enrichment from Aarhus Bay

Project description:Genome-resolved transcriptomics reveals novel organohalide-respiring bacteria from Aarhus Bay sediments

| PRJEB61282 | ENA

Organohalide-respiring Desulfoluna species

Project description:Genome sequence of organohalide-respiring Desulfoluna spongiiphila DBB and Desulfoluna butyratoxydans MSL71T

| PRJEB31368 | ENA