Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: The 16s RNA study of bleached and healthy corals collected from costal areas of Shenzhen, Guangdong, China

PROVIDER: PRJNA1051825 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR27208710_1.fastq.gz	Fastqsanger.gz
	SRR27208710_2.fastq.gz	Fastqsanger.gz
	SRR27208711_1.fastq.gz	Fastqsanger.gz
	SRR27208711_2.fastq.gz	Fastqsanger.gz
	SRR27208712_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 56

Similar Datasets

Microbiota of healthy and bleached corals, sediment, and seawater

Project description:Microbiota profile of healthy and bleached corals

| PRJNA691712 | ENA

Microbiota of healthy and bleached corals, sediment, and seawater

Project description:Microbiota profile of healthy and bleached corals

| PRJNA700134 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

The RNA-seq (miRNA and mRNA) analysis of three human osteosarcoma cells

Project description:RNA-seq analysis was performed by BGI-Tech of China, and RNA-seq library preparation and sequencing were performed by BGI (Shenzhen, China).

2017-06-13 | GSE89930 | GEO

Project description:The microbiome study of healthy and bleached corals in subtropical regions.

| PRJNA1014232 | ENA

Project description:The Symbiodiniaceae study of healthy and bleached corals in subtropical regions.

| PRJNA1014792 | ENA

Project description:The Symbiodiniaceae study of healthy and bleached corals in subtropical regions.

| PRJNA1055318 | ENA

Project description:The microbiome study of healthy and bleached corals in subtropical regions.

| PRJNA1013757 | ENA

De novo metatranscriptome assembly and coral gene expression profile of Montipora capitata with growth anomaly

Project description:Purpose: There is a dearth of knowledge regarding the molecular pathology of growth anomaly in corals. We investigated the gene expression profile of Montipora capitata metatranscriptomes from healthy and diseased (growth anomaly) coral colonies to elucidate differentially expressed genes. Methods: mRNA profiles of coral tissue (including symbionts) were generated from three different tissue states: healthy, affected and unaffected. Healthy tissue was collected from coral colonies not affected by growth anomaly. Affected tissue was collected from coral growth anomaly lesions. Unaffected tissue was collected from coral colonies affected by growth anomaly.

2017-06-20 | GSE97888 | GEO

Project description:Comparison of Viral Metagenomes from Bleached and Non-Bleached Pocillopora spp. Corals

| PRJNA647466 | ENA