Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Comparative analysis of MinION and MiSeq using 16S rRNA Gene Amplicon sequencing in human gut microbiome

PROVIDER: PRJNA1058165 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR27376000_1.fastq.gz	Fastqsanger.gz
	SRR27376001_1.fastq.gz	Fastqsanger.gz
	SRR27376002_1.fastq.gz	Fastqsanger.gz
	SRR27376003_1.fastq.gz	Fastqsanger.gz
	SRR27376004_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 133

Similar Datasets

Gut microbiome-derived bacterial extracellular vesicles in patients with solid tumours

Project description:In this study, we performed a comparative analysis of gut microbiota composition and gut microbiome-derived bacterial extracellular vesicles (bEVs) isolated from patients with solid tumours and healthy controls. After isolating bEVs from the faeces of solid tumour patients and healthy controls, we performed spectrometry analysis of their proteomes and next-generation sequencing (NGS) of the 16S gene. We also investigated the gut microbiomes of faeces from patientsand controls using 16S rRNA sequencing. Machine learning was used to classify the samples into patients and controls based on their bEVs and faecal microbiomes.

2024-08-08 | PXD047510 | Pride

Changes in intestinal permeability and gut microbiota following diet-induced weight loss in patients with metabolic dysfunction-associated steatohepatitis and liver fibrosis

Project description:We explore whether a low-energy diet intervention for Metabolic dysfunction-associated steatohepatitis (MASH) improves liver disease by means of modulating the gut microbiome. 16 individuals were given a low-energy diet (880 kcal, consisting of bars, soups, and shakes) for 12 weeks, followed by a stepped re-introduction to whole for an additional 12 weeks. Stool samples were obtained at 0, 12, and 24 weeks for microbiome analysis. Fecal microbiome were measured using 16S rRNA gene sequencing. Positive control (Zymo DNA standard D6305) and negative control (PBS extraction) were included in the sequencing. We found that low-energy diet improved MASH disease without lasting alterations to the gut microbiome.

2024-12-31 | E-MTAB-14061 | biostudies-arrayexpress

Chronic Strongyloides stercoralis infection increases Ruminococcus torques group and alter microbiome proteome in ivermectin treatment

Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.

2023-11-07 | PXD037975 | JPOST Repository

Gut microbiota: uterine fibroids patients vs. healthy control

Project description:Gut microbial profiling of uterine fibroids (UFs) patients comparing control subjects. The gut microbiota was examined by 16S rRNA quantitative arrays and bioinformatics analysis. The goal was to reveal alterations in the gut microbiome of uterine fibroids patients.

2022-03-05 | GSE197904 | GEO

Xenobiotics shape the physiology and gene expression of the active human gut microbiome

Project description:The human gut is colonized by trillions of microorganisms that influence human health and disease through the metabolism of xenobiotics, including therapeutic drugs and antibiotics. The diversity and metabolic potential of the human gut microbiome have been extensively characterized, but it remains unclear which microorganisms are active and which perturbations can influence this activity. Here, we use flow cytometry, 16S rRNA gene sequencing, and metatranscriptomics to demonstrate that the human gut contains distinctive subsets of active and damaged microorganisms, primarily composed of Firmicutes, which display marked temporal variation. Short-term exposure to a panel of xenobiotics resulted in significant changes in the physiology and gene expression of this active microbiome. Xenobiotic-responsive genes were found across multiple bacterial phyla, encoding novel candidate proteins for antibiotic resistance, drug metabolism, and stress response. These results demonstrate the power of moving beyond DNA-based measurements of microbial communities to better understand their physiology and metabolism. RNA-Seq analysis of the human gut microbiome during exposure to antibiotics and therapeutic drugs.

2012-10-30 | E-GEOD-38151 | biostudies-arrayexpress

16S rDNA sequencing of BALB/c and C57BL/7 mouse gut microbiomes

Project description:Age-dependent changes of the gut-associated microbiome have been linked to increased frailty and systemic inflammation. This study found that age-associated changes of the gut microbiome of BALB/c and C57BL/6 mice could be reverted by co-housing of aged (22 months old) and adult (3 months old) mice for 30-40 days or faecal microbiota transplantation (FMT) from adult into aged mice. This was demonstrated using high-throughput sequencing of the V3-V4 hypervariable region of bacterial 16S rRNA gene isolated from faecal pellets collected from 3-4 months old adult and 22-23 months old aged mice before and after co-housing or FMT.

2019-05-08 | E-MTAB-7750 | biostudies-arrayexpress

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Effect of trans-vaccenic acid(TVA) diet on 16S ribosomal RNA (rRNA) expression of mouse gut microbiome

Project description:To investigate the TVA diet's effect on mouse gut microbiome, we fed C57/BL6 mice with TVA diet or CON diet for 18 days We then collected feces of the mice and performed 16S ribosomal RNA (rRNA) sequencing.

2023-09-21 | GSE202266 | GEO

d5d72445-ec4a-4414-8c06-9e9324628c62 - samples

Project description:Off-target amplification can lead to false positive human brain microbiome detection. 16s rRNA amplicon samples from brain tissue of healthy and Parkinson's disease patients.

| EGAD00001006553 | EGA

Microbial community structure of a lotic aquatic system receiving wastewater effluent

Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles.

2016-01-01 | GSE73842 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data