Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1058782 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR27406349_1.fastq.gz | Fastqsanger.gz | |||
| SRR27406349_2.fastq.gz | Fastqsanger.gz | |||
| SRR27406350_1.fastq.gz | Fastqsanger.gz | |||
| SRR27406350_2.fastq.gz | Fastqsanger.gz | |||
| SRR27406351_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 36 |
Similar Datasets
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM). Examination of dmCas9 binding sites using two Trp53 targeting sgRNAs in Arf -/- MEF cell line (mouse).
2014-08-29 | E-GEOD-57650 | biostudies-arrayexpress
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM).
2014-08-29 | GSE57650 | GEO
Project description:Clustered regularly interspaced short palindromic repeats/CRISPR-associated protein (CRISPR/Cas) technologies have evolved rapidly over the past decade with the continuous discovery of new Cas systems. In particular, RNA-targeting CRISPR-Cas13 proteins are promising single-effector systems to regulate target mRNAs without altering genomic DNA, yet the current Cas13 systems are still restrained by suboptimal efficiencies. Here, we show that U1-driven CRISPR RNAs (crRNAs) can dramatically increase the efficiency of various applications, including RNA knockdown and editing, without modifying the Cas13 protein effectors. We confirm that U1-driven crRNAs are exported into the cytoplasm, while conventional U6 promoter-driven crRNAs are mostly confined in the nucleus. Furthermore, we reveal that the end positions of crRNAs expressed by the U1 promoter are consistent regardless of different guide sequences and lengths. We also demonstrate that U1-driven crRNAs, but not U6-driven crRNAs, can efficiently repress the translation of target genes in combination with catalytically inactive Cas13 proteins. Finally, we show that U1-driven crRNAs can counteract the inhibitory effect of miRNAs. Our simple and effective engineering enables unprecedented cytosolic RNA-targeting applications.
2024-09-15 | GSE275245 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Recent discovery of the gene editing system - CRISPR (Clustered Regularly Interspersed Short Palindromic Repeats) associated proteins (Cas), has resulted in its widespread use for improved understanding of a variety of biological systems, by enabling large-scale perturbation of the genomes and transcriptomes. Cas13, a lesser studied Cas protein, has been repurposed to allow for efficient and precise editing of RNA molecules. The Cas13 system utilizes base complementarity between a crRNA/sgRNA (crispr RNA or single guide RNA) and a target RNA transcript, to preferentially bind to only the target transcript. Unlike targeting the upstream regulatory regions of protein coding genes on the genome, the transcriptome is significantly more redundant, leading to many transcripts having wide stretches of identical nucleotide sequences. Transcripts also exhibit complex three-dimensional structures and interact with an array of RBPs (RNA Binding Proteins), both of which further limit the scope of effective target sequences. As a result, there currently exists no method to predict whether a specific sgRNA will effectively knockdown a transcript. Here we present a novel machine learning and computational tool, to predict the efficacy of a sgRNA. We used publicly available RNA knockdown data from cas13 characterization experiments1 for 555 sgRNAs targeting the transcriptome in HEK293 cells, in conjunction with transcriptome-wide protein occupancy information on RNA2. Our model utilizes a Decision Tree architecture with a set of 112 sequence and target availability features, to classify sgRNA efficacy into one of four classes, based upon expected level of target transcript knockdown. After accounting for noise in the training data set, the noise-normalized accuracy exceeds 90%. Additionally, highly effective sgRNA predictions have been experimentally validated using an independent RNA targeting cas system – CIRTS3, confirming the robustness and reproducibility of our model’s sgRNA predictions. In particular, several highly efficient sgRNA’s designed using our model against SMARCA4 gene exhibited strong agreement with experimental data supporting a 10-fold decrease in expression. Utilizing transcriptome wide protein occupancy information, CASowary can predict high quality guides for different transcripts in a cell specific manner. Applications of CASowary to whole transcriptomes should enable rapid deployment of CRISPR/Cas13 systems, facilitating the development of therapeutic interventions linked with aberrations in RNA regulatory processes.
2021-06-30 | GSE166189 | GEO
Project description:CRISPRs and TALENs are efficient systems for gene editing in many organisms including plants. In many cases the CRISPR-Cas or TALEN modules are expressed in the plant cell only transiently. Theoretically, transient expression of the editing modules should limit unexpected effects compared to stable transformation. However, very few studies have measured the off-target and unpredicted effects of editing strategies on the plant genome, and none of them have compared these two major editing systems. We conducted a comprehensive genome-wide investigation of off-target mutations using either a CRISPR-Cas9 or a TALEN strategy. We observed a similar number of SNVs and InDels for the two editing strategies compared to control non-transfected plants, with an average of 8.25 SNVs and 19.5 InDels for the CRISPR-edited plants, and an average of 17.5 SNVs and 32 InDels for the TALEN-edited plants. Interestingly, a comparable number of SNVs and InDels could be detected in the PEG-treated control plants. This shows that except for the on-target modifications, the gene editing tools used in this study did not show a significant off-target activity nor unpredicted effects on the genome, and that the PEG treatment in itself was probably the main source of mutations found in the edited plants.
2022-03-03 | E-MTAB-11497 | biostudies-arrayexpress
Project description:The clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system has emerged as a powerful technique for correcting genetic disease-causing mutations. However, in vivo gene editing using CRISPR/Cas9 remains a major challenge currently limiting its therapeutic application for disease correction. In the present study, we developed novel Cas9/gRNA nanocomplexes that lead to efficient in vivo gene targeting of neurons in the brain. We demonstrate the in vivo efficacy of Cas9-nanocomplexes as therapeutic agents for Alzheimer’s disease (AD) by targeting the BACE1 gene. Remarkably, in vivo BACE1 targeting by using Cas9-nanocomplexes results in decreased Aβ42 production and improvement of cognitive decline in an AD mouse model. These results suggest that Cas9-nanocomplexes represent an effective in vivo gene editing platform in the brain, and that this strategy may be applicable to the treatment of a broad range of neurological diseases.
2020-03-09 | GSE96065 | GEO
Project description:Base editors are RNA-guided deaminases that enable site-specific nucleotide transitions. The targeting scope of these Cas-deaminase fusion proteins critically depends on the availability of a protospacer adjacent motif (PAM) at the selected genomic locus, and is limited to a window within the CRISPR-Cas R-loop where single stranded (ss)DNA is accessible to the deaminase. Here, we reason that the Cas9-HNH nuclease domain sterically constrains ssDNA accessibility, and demonstrate that omission of this domain expands the editing window. By exchanging the HNH nuclease domain with an adenosine deaminase, we furthermore engineer adenine base editor variants (HNHx-ABE) with PAM-proximally shifted editing windows. HNHx-ABEs are substantially reduced in size, and expand the targeting scope of base editors. Our finding that the HNH domain is replaceable could moreover benefit future protein engineering efforts, where Cas9 operates together with other enzyme domains.
2020-11-12 | GSE161380 | GEO
Project description:Base editors are RNA-guided deaminases that enable site-specific nucleotide transitions. The targeting scope of these Cas-deaminase fusion proteins critically depends on the availability of a protospacer adjacent motif (PAM) at the selected genomic locus, and is limited to a window within the CRISPR-Cas R-loop where single stranded (ss)DNA is accessible to the deaminase. Here, we reason that the Cas9-HNH nuclease domain sterically constrains ssDNA accessibility, and demonstrate that omission of this domain expands the editing window. By exchanging the HNH nuclease domain with an adenosine deaminase, we furthermore engineer adenine base editor variants (HNHx-ABE) with PAM-proximally shifted editing windows. HNHx-ABEs are substantially reduced in size, and expand the targeting scope of base editors. Our finding that the HNH domain is replaceable could moreover benefit future protein engineering efforts, where Cas9 operates together with other enzyme domains.
2020-11-12 | GSE161379 | GEO