Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Madracis auretenra

ABSTRACT: Madracis auretenra 16S rRNA V4 Raw sequence reads

PROVIDER: PRJNA1103847 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR28786300_1.fastq.gz	Fastqsanger.gz
	SRR28786300_2.fastq.gz	Fastqsanger.gz
	SRR28786301_1.fastq.gz	Fastqsanger.gz
	SRR28786301_2.fastq.gz	Fastqsanger.gz
	SRR28786302_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 144

Similar Datasets

Madracis auretenra

Project description:Madracis auretenra overview

| PRJNA1117171 | ENA

Madracis decactis

Project description:Madracis decactis Taq-seq raw sequence reads throughout exposure to experimental cis and trans priming

| PRJNA1308128 | ENA

Madracis senaria

Project description:Madracis senaria overview

| PRJNA1199131 | ENA

Madracis decactis

Project description:Madracis decactis overview

| PRJNA1308253 | ENA

coral metagenome

Project description:Porites sp 16S rRNA V4 Raw sequence reads

| PRJNA1104183 | ENA

Targeting the treponemal microbiome of digital dermatitis infections by deep coverage pyrosequencing

Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.

2013-06-25 | GSE42426 | GEO

Microbiota of Breast cancer in Algerian females

Project description:v3-v4 16S rRNA sequencing was used to characterize the differences in microbiota between specimens of breast cancer and healthy surrounding tissue in adult Algerian females

2025-07-30 | GSE243440 | GEO

Evaluating the gut microbiota shifts caused by two diets based on ancient grains

Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2022-08-24 | GSE206807 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO