Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Madracis auretenra

ABSTRACT: Madracis auretenra 16S rRNA V4 Raw sequence reads

PROVIDER: PRJNA1103847 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR28786300_1.fastq.gz	Fastqsanger.gz
	SRR28786300_2.fastq.gz	Fastqsanger.gz
	SRR28786301_1.fastq.gz	Fastqsanger.gz
	SRR28786301_2.fastq.gz	Fastqsanger.gz
	SRR28786302_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 144

Similar Datasets

Madracis auretenra

Project description:Madracis auretenra overview

| PRJNA1117171 | ENA

Madracis senaria

Project description:Madracis senaria overview

| PRJNA1199131 | ENA

coral metagenome

Project description:Porites sp 16S rRNA V4 Raw sequence reads

| PRJNA1104183 | ENA

Targeting the treponemal microbiome of digital dermatitis infections by deep coverage pyrosequencing

Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.

2013-06-25 | GSE42426 | GEO

Evaluating the gut microbiota shifts caused by two diets based on ancient grains

Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2022-08-24 | GSE206807 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

852d5472-a05f-4ee7-b957-394cf1a1a078 - samples

Project description:Metadata for fecal 16S-V4 rRNA gene sequence data from NCT02749630 healthy volunteers.

| EGAD00001008821 | EGA

Morus alba Raw protein sequence reads

Project description:Morus alba L. Raw protein sequence reads and sequence

2024-02-08 | PXD049451 |

Comparing the microbiota composition between Cocaine addicted and Healthy subjects and the corresponding shift caused by rTMS treatment.

Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-05-31 | GSE206765 | GEO

bovine metagenome

Project description:bovine colostrum 16S rRNA V3-V4 Raw sequence reads

| PRJNA612492 | ENA