Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1107511 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR28884500_1.fastq.gz | Fastqsanger.gz | |||
| SRR28884500_2.fastq.gz | Fastqsanger.gz | |||
| SRR28884600_1.fastq.gz | Fastqsanger.gz | |||
| SRR28884600_2.fastq.gz | Fastqsanger.gz | |||
| SRR28884501_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 264 |
Similar Datasets
Project description:The anaerobic digestion microbiomes has been puzzling us since the dawn of molecular methods for mixed microbial community analysis. Monitoring of the anaerobic digestion microbiome can either take place via a holistic evaluation of the microbial community through fingerprinting or by targeted monitoring of selected taxa. Here, we compared four different microbial community fingerprinting methods, i.e., amplicon sequencing, metaproteomics, metabolomics and phenotypics, in their ability to reflect the full-scale anaerobic digestion microbiome. The phenotypic fingerprinting reflects a, for anaerobic digestion, novel, single cell-based approach of direct microbial community fingerprinting. Three different digester types, i.e., sludge digesters, digesters treating agro-industrial waste and dry anaerobic digesters reflected different operational parameters. The α-diversity analysis yielded inconsistent results, especially for richness, across the different methods. In contrast, β-diversity analysis resulted in comparable profiles, even when translated into phyla or functions, with clear separation of the three digester types. In-depth analysis of each method's features i.e., operational taxonomic units, metaproteins, metabolites, and phenotypic traits, yielded certain similar features yet, also some clear differences between the different methods, which was related to the complexity of the anaerobic digestion process. In conclusion, phenotypic fingerprinting is a reliable, fast method for holistic monitoring of the anaerobic digestion microbiome, and the complementary identification of key features through other methods could give rise to a direct interpretation of anaerobic digestion process performance.
2021-05-26 | PXD024788 | Pride
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
2022-03-01 | PXD009773 | Pride
Project description:Anaerobic digester 16S rRNA metagene
| PRJNA842549 | ENA
Project description:Anaerobic digester 16S rRNA Metagenome
| PRJNA679158 | ENA
Project description:Anaerobic digester 16S rRNA metagene
| PRJNA951939 | ENA
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
2017-05-12 | PXD006118 | Pride
Project description:16S amplicon analysis of floor dust samples collected from a kindergarten over an 11 month period
| PRJEB26846 | ENA
Project description:Anaerobic digestion is a popular and effective microbial process for waste treatment. The performance of anaerobic digestion processes is contingent on the balance of the microbial food web in utilizing various substrates. Recently, co-digestion, i.e., supplementing the primary substrate with an organic-rich co-substrate has been exploited to improve waste treatment efficiency. Yet the potential effects of elevated organic loading on microbial functional gene community remains elusive. In this study, functional gene array (GeoChip 5.0) was used to assess the response of microbial community to the addition of poultry waste in anaerobic digesters treating dairy manure. Consistent with 16S rRNA gene sequences data, GeoChip data showed that microbial community compositions were significantly shifted in favor of copiotrophic populations by co-digestion, as taxa with higher rRNA gene copy number such as Bacilli were enriched. The acetoclastic methanogen Methanosarcina was also enriched, while Methanosaeta was unaltered but more abundant than Methanosarcina throughout the study period. The microbial functional diversity involved in anaerobic digestion were also increased under co-digestion.
2017-01-12 | GSE93419 | GEO
Project description:Anaerobic digesters' 16S rRNA amplicon Metagenome
| PRJNA706855 | ENA
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO