Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S rRNA sequencing of colonnic contents in mice

PROVIDER: PRJNA1109982 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR29108349_1.fastq.gz	Fastqsanger.gz
	SRR29108349_2.fastq.gz	Fastqsanger.gz
	SRR29108350_1.fastq.gz	Fastqsanger.gz
	SRR29108350_2.fastq.gz	Fastqsanger.gz
	SRR29108351_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 32

Similar Datasets

Nobiletin ameliorates high fat-induced disruptions in rhythmic glucagon-like peptide-1 secretion - 16S

Project description:16S rRNA gene sequencing of colonic feces from mice fed regular chow, regular chow+nobiletin, high-fat diet or high-fat diet+nobiletin.

2022-05-06 | E-MTAB-11551 | biostudies-arrayexpress

16S rRNA sequencing of fecal samples from Atg16l1 T300A and wildtype littermate mice that were either exposed or not to mainstream cigarette smoking for 6 weeks

Project description:We found that mainstream cigarette smoking (4 cigarettes/day, 5 days/week for 2 weeks using Kentucky Research Cigarettes 3R4F) resulted in >20% decrease in the percentage of normal Paneth cell population in Atg16l1 T300A mice but showed minimal effect in wildtype littermate control mice, indicating that Atg16l1 T300A polymorphism confers sensitivity to cigarette smoking-induced Paneth cell damage. We performed 16S rRNA sequencing to identify potential microbiota changes associated with Paneth cell defect in Atg16l1 T300A mice exposed to cigarette smoking. Female mice were used at 4-5 weeks of age. Cigarette smoking was performed using smoking chamber with the dosage and schedule as described above. The fecal samples from the mice were collected for 16S rRNA sequencing analysis after completing 6 weeks of smoking.

2018-10-31 | E-MTAB-5717 | biostudies-arrayexpress

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

16s rRNA-young and old mouse gut microbiota-stroke

Project description:To explore the effects of gut microbiota of young (8 weeks) or old mice (18～20 months) on stroke, feces of young (Y1-Y9) and old mice (O6-O16) were collected and analyzed by 16s rRNA sequencing. Then stroke model was established on young mouse receive feces from old mouse (DOT1-15) and young mouse receive feces from young mouse (DYT1-15). 16s rRNA sequencing were also performed for those young mice received feces from young and old mice.

2021-10-15 | E-MTAB-10837 | biostudies-arrayexpress

Project description:16S rRNA of mice cecal contents

| PRJNA842506 | ENA

Study of Gut Microbiome and Colorectal Tumors

Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.

| 2255499 | ecrin-mdr-crc

Escherichia coli

Project description:16S rRNA analysis of mice cecal contents

| PRJNA522846 | ENA

Project description:16S rRNA analysis of mice cecal contents

| PRJNA517765 | ENA

Chronic Strongyloides stercoralis infection increases Ruminococcus torques group and alter microbiome proteome in ivermectin treatment

Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.

2023-11-07 | PXD037975 | JPOST Repository

Project description:16S rRNA sequencing of colon contents in hyperuricemia mice

| PRJNA1146554 | ENA