Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1117079 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR29198500_1.fastq.gz | Fastqsanger.gz | |||
| SRR29198500_2.fastq.gz | Fastqsanger.gz | |||
| SRR29198501_1.fastq.gz | Fastqsanger.gz | |||
| SRR29198501_2.fastq.gz | Fastqsanger.gz | |||
| SRR29198502_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 350 |
Similar Datasets
Project description:Because of their smallness, the recently developed CRISPR-Cas12f nucleases can be effectively packaged into adeno-associated viruses for gene therapy. However, a systematic evaluation of the editing outcomes of CRISPR-Cas12f is lacking. In this study, we apply a high-throughput sequencing method to comprehensively assess the editing efficiency, specificity, and safety of four Cas12f proteins in parallel with that of Cas9 and two Cas12a proteins at multiple genomic sites. Cas12f nucleases achieve robust cleavage at most of the tested sites and mainly produce deletional fragments. In contrast, Cas9 and Cas12a show relatively higher editing efficiency at the vast majority of the tested sites. However, the off-target hotspots identified in the Cas9- and Cas12a-edited cells are negligibly detected in the Cas12f-edited cells. Moreover, compared to Cas9 and Cas12a nucleases, Cas12f nucleases reduce the levels of chromosomal translocations, large deletions, and integrated vectors by 2- to 3-fold. Therefore, our findings confirm the editing capacity of Cas12f and reveal the ability of this nuclease family to preserve genome integrity during genome editing.
2022-09-12 | GSE213149 | GEO
Project description:Based on the hypothesis that, enhancing the local concentration of donor oligos could increase the correction rates, we generated and tested novel CRISPR-Cas9 systems, in which the DNA repair template is covalently conjugated to Cas9 (RNPD system). To validate our results from the HEK293T reporter cells, we here tested our approach at different endogenous genomic loci and in different cell types. We first targeted the human beta globin (HBB) locus in the K562 cell line, and analyzed correction- and editing frequencies using next generation sequencing (NGS). Next we targeted the Rosa26 and proprotein convertase subtilisin/kexin type 9 (Pcsk9) locus in mouse embryonic stem cells (mESCs). Here, RNPD system was always compared to Cas9 SNAP-tag fusion proteins with uncoupled donor oligos. To also directly compare the engineered RNPD system to the classical CRISPR-Cas9 system, we performed experiments where we used wild-type Cas9 with the uncoupled donor oligos as a control. We therefore targeted the fluorescent reporter locus as well as the endogenous loci HBB, empty spiracles homeobox 1 (EMX1), and C-X-C chemokine receptor type 4 (CXCR4) in HEK293T cells. Finally, we performed the analysis of three computationally predicted off-target sites of the reporter locus.
2018-06-04 | E-MTAB-6808 | biostudies-arrayexpress
Project description:The use of CRISPR/Cas proteins for the creation of multiplex genome-engineering represents an important avenue for crop improvement, and further improvements for creation of knock-in plant lines via CRISPR-based technologies may enable the high-throughput creation of designer alleles. To circumvent limitations of the commonly used CRISPR/Cas9 system for multiplex genome-engineering, we explored the use of Moraxella bovoculi 3 Cas12a (Mb3Cas12a) for multiplex genome-editing in Arabidopsis thaliana. We identified optimized promoter sequences for driving expression of single transcript multiplex crRNA arrays in A. thaliana, resulting in stable germline transmission of Mb3Cas12a-edited alleles at multiple target sites. By utilizing this system, we demonstrate single-transcript multiplexed genome-engineering using of up to 13 crRNA targets. We further show high target specificity of Mb3Cas12a-based genome-editing via whole-genome sequencing. Taken together, our method provides a simplified platform for efficient multiplex-genome-engineering in plant-based systems.
2021-09-15 | GSE162875 | GEO
Project description:We performed a large-scale genome-wide characterisation of indels generated following editing with CRISPR/Cas9. We used pools of sgRNAs and performed targeted capture and sequencing of the edited regions in HepG2 cells.
2018-12-13 | E-MTAB-7095 | biostudies-arrayexpress
Project description:RNA-guided genome editing with the CRISPR-Cas9 system has great potential for basic and clinical research, but the determinants of targeting specificity and the extent of off-target cleavage remain insufficiently understood. Using chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq), we mapped genome-wide binding sites of catalytically inactive Cas9 (dCas9) in HEK293T cells, in combination with 12 different single guide RNAs (sgRNAs). The number of off-target sites bound by dCas9 varied from ~10 to >1,000 depending on the sgRNA. Analysis of off-target binding sites showed the importance of the PAM-proximal region of the sgRNA guiding sequence and that dCas9 binding sites are enriched in open chromatin regions. When targeted with catalytically active Cas9, some off-target binding sites had indels above background levels in a region around the ChIP-seq peak, but generally at lower rates than the on-target sites. Our results elucidate major determinants of Cas9 targeting, and we show that ChIP-seq allows unbiased detection of Cas9 binding sites genome-wide 1.sgRNA1-6 binding sites were identified with ChipSeq by using HA antibody (there are 2 replicates for sgRNA1-3, one sample for sgRNA4-6,one control without sgRNA) 2.PCR products which amplifies " off-target genomic sites" were deep sequenced in the presence of WT Cas9+sgRNA or WT Cas9 alone( unique adaptor was used for each sgRNA and mixed for multiplex run)
2014-05-18 | E-GEOD-55887 | biostudies-arrayexpress
Project description:The CRISPR-Cas12a platform has attracted interest in the genome editing community because the prototypic Acidaminococcus Cas12a generates a staggered DNA double-strand break upon binding to an AT-rich protospacer-adjacent motif (PAM, 5'-TTTV). The broad application of the platform in primary human cells was enabled by the development of an engineered version of the natural Cas12a protein, called Cas12a Ultra. In this study, we confirmed that CRISPR-Cas12a Ultra ribonucleoprotein complexes enabled allelic gene disruption frequencies of over 90% at multiple target sites in human T cells, hematopoietic stem and progenitor cells (HSPCs), and induced pluripotent stem cells (iPSCs). In addition, we demonstrated for the first time the efficient knock-in potential of the platform in human iPSCs and achieved targeted integration of a GFP marker gene into the AAVS1 safe harbor site and a CSF2RA super-exon into CSF2RA in up to 90% of alleles without selection. Clonal analysis revealed bi-allelic integration in >50% of the screened iPSC clones without compromising their pluripotency and genomic integrity. Thus, in combination with the adeno-associated virus vector system, CRISPR-Cas12a Ultra provides a highly efficient genome editing platform for performing targeted knock-ins in human iPSCs.
2024-02-09 | GSE249731 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:To compare the impact of CRISPR-egineered R175 TP53 mutant variants in HCT116 and H460 cells, mutations at the amino acid position 175 were generated systematically by CRISP/Cas9 editing. Here, genomic amplicon regions covering the TP53 Exons 5 were sequenced via targeted sequencing.
2024-10-16 | E-MTAB-14322 | biostudies-arrayexpress
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM). Examination of dmCas9 binding sites using two Trp53 targeting sgRNAs in Arf -/- MEF cell line (mouse).
2014-08-29 | E-GEOD-57650 | biostudies-arrayexpress
Project description:Cas12a CRISPR technology, unlike Cas9, allows for multiplexing guide RNAs from a single transcript, simplifying combinatorial perturbations. While Cas12a has been implemented for multiplexed knockout genetic screens, it has yet to be optimized for CRISPR activation (CRISPRa) screens in human cells. Here we develop a new Cas12a-based transactivation domain (TAD) recruitment system using the ALFA nanobody and demonstrate simultaneous activation of up to four genes. We screen a genome-wide library to identify modulators of growth and MEK inhibition, and we compare these results to those obtained with open reading frame (ORF) overexpression and Cas9-based CRISPRa. We find that the activity of multiplexed arrays is largely predictable from the best-performing guide and we provide criteria for selecting active guides. We anticipate that these results will greatly accelerate the exploration of gene function and combinatorial phenotypes at scale.
2023-05-08 | GSE230445 | GEO