Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Characterization of Microbial Communities in Five Traditional Chinese Medicines Using High-Throughput 16s rRNA Sequencing

PROVIDER: PRJNA1133095 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR29743900_1.fastq.gz	Fastqsanger.gz
	SRR29743900_2.fastq.gz	Fastqsanger.gz
	SRR29743901_1.fastq.gz	Fastqsanger.gz
	SRR29743901_2.fastq.gz	Fastqsanger.gz
	SRR29743902_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 60

Similar Datasets

Project description:Traditional Chinese Medicines ameliorate NAFLD

| PRJNA726732 | ENA

Project description:Pelodiscus sinensis Treated with Traditional Chinese Medicines

| PRJNA1107275 | ENA

Project description:16S rRNA High-Throughput Sequencing

| PRJNA464196 | ENA

Project description:16s rRNA high-throughput sequencing

| PRJNA794205 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Sourdough

Project description:16S rDNA high-throughput sequencing of bacteria from Chinese traditional sourdoughs Raw sequence reads

| PRJNA396811 | ENA

Differences in serum proteins in traditional Chinese medicine constitutional population: analysis and verification

Project description:Using high-throughput antibody microarray, through cross-sectional sample detection and verification of samples that had undergone physical changes over time, it was found that people with balanced constitution and dampness constitution in Chinese medicine showed differences in serum protein expression. The differences were expressed as the level changes of 19 proteins such as Dectin-2, Siglec-7, AIF and TACI. The research results provided the basis for the scientific expression of traditional Chinese medicine (TCM) constitution.

2019-11-22 | GSE140769 | GEO

Project description:16S rRNA gene high-throughput sequencing

| PRJNA1153362 | ENA

Project description:16S rRNA gene high-throughput sequencing

| PRJNA874856 | ENA

Project description:High-throughput sequencing of 16S rRNA

| PRJNA903654 | ENA