Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
Project description:We investigated changes in rumen fermentation, peripheral blood metabolites and hormones, and hepatic transcriptomic dynamics in Holstein cows with and those without subacute ruminal acidosis (SARA) during the periparturient period.
Project description:Diseases caused by parasitic flatworms of rumen tissues (paramphistomosis) are a significant threat to global food security as a cause of morbidity and mortality in ruminant livestock in subtropical and tropical climates. Calicophoron daubneyi is currently the only paramphistome species commonly infecting livestock species in temperate European climates. However, recorded incidences of C. daubneyi infection in European livestock have been increasing over the last decade. Whilst clinical paramphistomosis caused by adult worms is currently uncommon in Europe, fatalities have been reported in association with severe haemorrhagic enteritis resulting from the migration of immature paramphistomes. Large numbers of mature adults can reside in the rumen, yet to date, the impact on rumen fermentation, and consequently in productivity and economic management of infected livestock have not been resolved. Limited public available nucleotide and protein sequences for C. daubneyi underpin this lack of biological and economic understanding. Here we present for the first time a de novo assembled transcriptome, with functional annotations, for adult C. daubneyi, which provides a reference database for protein and nucleotide sequence identification to facilitate fundamental biology, anthelmintic, vaccine and diagnostics discoveries. This dataset identifies a number of genes potentially unique to C. daubneyi and, by comparison to an existing transcriptome for the related Paramphistomum cervi, identifies novel genes which may be unique to the paramphistome group of platyhelminthes. Additionally, we present the first coverage of the excretory/secretory and soluble somatic proteome profiles for adult C. daubneyi and identify the release of extracellular vesicles from adult C. daubneyi parasites during in vitro, ex-host culture. Finally, we have performed the first analysis of rumen fluke impacting upon rumen fermentation parameters using an in vitro gas production study resulting in a significant increase in propionate production.
