Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Nonpathogenic E. coli displaying decoy-resistant IL18 mutein enhance the efficacy of cancer immunotherapies

ABSTRACT: Nonpathogenic E. coli displaying decoy-resistant IL18 mutein enhance the efficacy of cancer immunotherapies

PROVIDER: PRJNA1150592 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR30331620_1.fastq.gz	Fastqsanger.gz
	SRR30331620_2.fastq.gz	Fastqsanger.gz
	SRR30331621_1.fastq.gz	Fastqsanger.gz
	SRR30331621_2.fastq.gz	Fastqsanger.gz
	SRR30331622_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 32

Similar Datasets

Nonpathogenic E. coli displaying decoy-resistant IL18 mutein enhance the efficacy of cancer immunotherapies

Project description:The tumor microenvironment can inhibit the efficacy of cancer therapies through mechanisms such as poor trafficking and exhaustion of immune cells. To address this challenge, we exploited the safety, tumor tropism, and ease of genetic manipulation of non-pathogenic Escherichia coli (E. coli) to deliver key immune-activating cytokines to tumors via surface display on the outer membrane of E. coli K-12 DH5a. Non-pathogenic E.coli expressing murine decoy-resistant IL18 mutein (DR18) induced robust CD8+ T and NK cell-dependent immune responses and suppressed tumor progression in immune-competent colorectal carcinoma and melanoma mouse models. E. coli K-12 DH5a engineered to display human DR18 potently activated mesothelin-targeting CAR NK cells and enhance their trafficking into tumors, which extended survival in an NK cell treatment-resistant mesothelioma xenograft model by enhancing TNFa signaling and upregulating NK activation markers. Our live bacteria-based immunotherapeutic system safely and effectively induces potent anti-tumor responses in treatment-resistant solid tumors, motivating further evaluation of this approach in the clinic.

2024-08-22 | GSE275391 | GEO

Gene expression analysis of the hippocampus in Il18+/+ and Il18-/- with restraint stress

Project description:Interleukin-18 (IL-18) was one of the inflammatory cytokines and related to major depressive disorder (MDD) and dementia. We previously investigated IL-18 knockout (Il18−/−) mice developed impaired learning and memory, more anxiety, and less motivation comparing to Il18+/+ mice. In the Il18−/− mice with acute stress, both the immobility time in the forced swim test and the tail suspension test were decreased, even though no difference was observed in the Il18+/+ mice. To reveal the mechanism, RNA-Seq was performed.

2022-10-21 | GSE207669 | GEO

Gene expression analysis of the hippocampus in Il18+/+ and Il18-/- mice at 12 weeks of age

Project description:Interleukin-18 (IL-18) was one of the inflammatory cytokines and related to major depressive disorder (MDD) and dementia. Compared with Il18+/+ mice, IL-18 knockout (Il18−/−) mice developed impaired learning and memory, more anxiety, and less motivation. To reveal the mechanism, the microarray was performed.

2019-12-31 | GSE108485 | GEO

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design

2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress

Cell cycle motif decoy oligos

2012-08-23 | GSE39572 | GEO

Gene expression analysis of the hippocampus in Il18+/+ and Il18-/- with restraint stress

Project description:Gene expression analysis of the hippocampus in Il18+/+ and Il18-/- with restraint stress

| PRJNA856658 | ENA

An IL-2 mutein increases IL-10 and CTLA-4-dependent suppression of dendritic cells by regulatory T cells [RNA-seq]

Project description:Interleukin-2 (IL-2) variants with increased CD25 dependence that selectively expand Foxp3+ regulatory T (TR) cells are in clinical trials for treating inflammatory diseases. Using an Fc-fused IL-2 mutein (Fc.IL-2 mutein) we developed that prevents diabetes in non-obese diabetic (NOD) mice, we show that Fc.IL-2 mutein induced an activated TR population with elevated proliferation, a transcriptional program associated with Stat5- and TCR-dependent gene modules, and high IL-10 and CTLA-4 expression. Increased IL-10 signaling limited surface MHC class II upregulation during conventional dendritic cell (cDC) maturation, while increased CTLA-4-dependent transendocytosis led to the transfer of CD80 and CD86 costimulatory ligands from maturing cDCs to TR cells. In NOD mice, Fc.IL-2 mutein treatment promoted the suppression of cDCs in the inflamed pancreas and pancreatic lymph nodes resulting in T cell anergy. Thus, IL-2 mutein-expanded TR cells have enhanced functional properties and restrict cDC function, offering promise for targeted immunotherapy use in autoimmune disease.

2023-12-08 | GSE249186 | GEO

Expression data from U87-2M1 glioma cells transduced with baculoviral control decoy vector or baculoviral miR-10b decoy vector

Project description:MicroRNA-10b may target numerous genes in gliomagenesis. The target genes of miR-10b may differ according to the cellular context. We used microarray analyses to determine the phenotypic effects and gene targets of miR-10b by silencing miR-10b in invasive U87-2M1 glioma cells. Early passage U87-2M1 cells treated with the baculoviral control decoy vector or miR-10b decoy vector were selected for RNA extraction and hybridization on microarray

2012-12-31 | E-GEOD-35170 | biostudies-arrayexpress

Gene expression analysis of the hippocampus in Il18+/+ and Il18-/- mice at 12 weeks of age

Project description:Gene expression analysis of the hippocampus in Il18+/+ and Il18-/- mice at 12 weeks of age

| PRJNA427398 | ENA

An IL-2 mutein increases IL-10 and CTLA-4-dependent suppression of dendritic cells by regulatory T cells [10x scRNA-seq]

Project description:Interleukin-2 (IL-2) variants with increased CD25 dependence that selectively expand Foxp3+ regulatory T (TR) cells are under clinical investigation for treating autoimmune and inflammatory diseases. We previously described an Fc-fused CD25-biased IL-2 mutein (Fc.IL-2 mutein) that promotes TR expansion and prevents the onset of autoimmune diabetes in non-obese diabetic (NOD) mice; however, the effects of this treatment on TR function in vivo are unclear. Here we show that Fc.IL-2 mutein treatment induces an activated Foxp3+ TR population characterized by elevated proliferation, a unique transcriptional program associated with Stat5- and TCR-dependent gene modules, and high levels of the immunosuppressive molecules IL-10 and CTLA-4. Increased IL-10 receptor signaling limits the upregulation of surface MHC class II expression during conventional dendritic cell (cDC) maturation, while increased CTLA-4-dependent transendocytosis leads to the transfer of CD80 and CD86 costimulatory ligands from maturing cDCs to Tregs. In NOD mice, Fc.IL-2 mutein treatment resulted in TR-mediated regulation of cDCs in the inflamed pancreas and draining lymph nodes accompanied by an increase in anergic T cells. Thus, we demonstrate that IL-2 mutein-expanded TR cells have enhanced functional properties and potently act to restrict cDC function in the target tissue and at the site of autoimmune induction, offering promising prospects for targeted immunotherapy.

2023-12-08 | GSE249481 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data