ABSTRACT: Sequence-independent single-primer amplification and Oxford Nanopore MinION sequencing decipher the viral genomic diversity in South African domestic chickens
Project description:To evaluate targeted MinION next generation sequencing as a diagnostic method for detection of pathogens in human blood and plasma, human blood or plasma samples were spiked with measured amounts of viruses, bacteria, protozoan parasites or tested pathogen-free as negative controls. Nucleic acid was extracted from samples and PCR amplification performed in multiplex primer pools with a procedure described in ArrayExpress experiment submission ID 18379. The PCR products were used for library preparation. The libraries sequenced on an Oxford Nanopore MinION. The passed reads aligned with a custom reference file to determine the identity of the pathogen in the sample.
Project description:We applied direct RNA long read sequencing for characterization of transcripts from constructs inserted into HEK293T mammalian cells with different promoters. Direct RNA sequencing was performed on an Oxford Nanopore GridION device using the Direct Sequencing Kit (SQK-RNA004, date accessed 15 May 2024), MinION RNA flow cell (FLO-MIN00RA), and data pre-processing was performed with MinKNOW (v24.06.10).
Project description:In this experiment we wanted to see how the binding behavior of the S. Cerevisiae transcription factor Leu3, on of the main regulators of leucine biosynthesis, is affected by different availability of the branched chain amino acids. For this we grow the cells in shake flask under glucose limitation and treated them 2 hours before sampling. The cells were then cross-linked with formaldehyde and ChIP-seq was performed using the Oxford Nanopore MinIon.
Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.
Project description:S. meliloti strains with a bi- and monopartite genome configuration were constructed by consecutive Cre/lox-mediated site-specific fusions of the secondary replicons. Beside the correct genomic arrangements, these strains and precursors were tested for variations in the nucleotide sequence. Futher, a marker fequency analysis was performed to test if replication is initiated at all origins and to determine the replication termination regions of the triple replicon fusion molecule. To gain the sequence data for these analyses, respective strains were applied to whole genome sequencing using an Illumina MiSeq-System and Oxford Nanopore (MinION) sequencing technology.
Project description:Duckweeds are a monophyletic group of rapidly reproducing aquatic monocots in the Lemnaceae family. Spirodela polyrhiza, the Greater Duckweed, has the largest body plan yet the smallest genome size in the family (1C = 150 Mb). Given their clonal, exponentially fast reproduction, a key question is whether genome structure is conserved across the species in the absence of meiotic recombination. We generated a highly contiguous, chromosome-scale assembly of Spirodela polyrhiza line Sp7498 using Oxford Nanopore plus Hi-C scaffolding (Sp7498_HiC) that is highly syntenic with a related line (Sp9509). Both the Sp7498_HiC and Sp9509 genome assemblies reveal large chromosomal misorientations in a recent PacBio assembly of Sp7498, highlighting the necessity of orthogonal long-range scaffolding techniques like Hi-C and BioNano optical mapping. Proteome analysis of Sp7498 verified the expression of nearly 2,250 proteins and revealed a high level of proteins involved in photosynthesis and carbohydrate metabolism among other functions. In addition, a strong increase in chloroplast proteins was observed that correlated to chloroplast density. This Sp7498_HiC genome was generated cheaply and quickly with a single Oxford Nanopore MinION flow cell and one Hi-C library in a classroom setting. Combining these data with a mass spectrometry-generated proteome, demonstrates that duckweed is a model for genomics- and proteomics-based education.
Project description:Higher-order chromatin structure arises from the combinatorial physical interactions of many genomic loci. To investigate this aspect of genome architecture we developed Pore-C, which couples chromatin conformation capture with Oxford Nanopore Technologies (ONT) long reads to directly sequence multi-way chromatin contacts without amplification.