Project description:In this study, we performed a comparative analysis of gut microbiota composition and gut microbiome-derived bacterial extracellular vesicles (bEVs) isolated from patients with solid tumours and healthy controls. After isolating bEVs from the faeces of solid tumour patients and healthy controls, we performed spectrometry analysis of their proteomes and next-generation sequencing (NGS) of the 16S gene. We also investigated the gut microbiomes of faeces from patientsand controls using 16S rRNA sequencing. Machine learning was used to classify the samples into patients and controls based on their bEVs and faecal microbiomes.
Project description:Rapidly increased studies by third-generation sequencing [Pacific Biosciences (Pacbio) and Oxford Nanopore Technologies (ONT)] have been used in all kinds of research areas. Among them, the plant full-length single-molecule transcriptome studies were most used by Pacbio while ONT was rarely used. Therefore, in this study, we developed ONT RNA-sequencing methods in plants. We performed a detailed evaluation of reads from Pacbio and Nanopore PCR cDNA (ONT Pc) sequencing in plants (Arabidopsis), including the characteristics of raw data and identification of transcripts. We aimed to provide a valuable reference for applications of ONT in plant transcriptome analysis.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
Project description:Chromatin immunoprecipitation analysis of CENH3 in the Arabidopsis thaliana accessions Col-0, Ler-0, Cvi-0 and Tanz-1 was performed in order to align reads to PacBio HiFi genome assemblies which contain complete centromere repeat arrays.
