Multi-modal investigation reveals pathogenic features of diverse DDX3X missense mutations
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1170309 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:De novo mutations in the RNA binding protein DDX3X cause neurodevelopmental disorders including DDX3X syndrome and autism spectrum disorder. Amongst ~200 mutations identified to date, half are missense. While DDX3X loss of function is known to impair neural cell fate, how the landscape of missense mutations impacts neurodevelopment is almost entirely unknown. Here, we integrate transcriptomics, proteomics, and live imaging to demonstrate clinically diverse DDX3X missense mutations perturb neural development via distinct cellular and molecular mechanisms. Using mouse primary neural progenitors, we investigate four recurrently mutated DDX3X missense variants, from clinically severe (2) to mild (2). While clinically severe mutations impair neurogenesis, mild mutations have only a modest impact on cell fate. Moreover, expression of severe mutations leads to profound neuronal death. Using a proximity labeling screen in neural progenitors, we discover DDX3X missense variants have unique protein interactors. We observe notable overlap amongst severe mutations, suggesting common mechanisms underlying altered cell fate and survival. Transcriptomic analysis and subsequent cellular investigation highlights new pathways associated with DDX3X missense variants, including upregulated DNA Damage Response. Notably, clinically severe mutations exhibit excessive DNA damage in neurons, associated with aberrant cytoplasmic DNA:RNA hybrids and formation of stress granules. These findings highlight aberrant RNA metabolism and DNA damage in DDX3X-mediated neuronal cell death. In sum our findings reveal new mechanisms by which clinically distinct DDX3X missense mutations differentially impair neurodevelopment.
2025-01-06 | GSE279078 | GEO
Project description:DDX3X is an ATP-dependent RNA helicase. Missense mutations in DDX3X gene are known to occur in WNT, SHH subgroup medulloblastomas. The role of DDX3X in medulloblastoma biology was studied by downregulating its expression in a SHH subgroup Daoy medulloblastoma cell line. DDX3X knockdown resulted in considerable reduction in proliferation, clonogenic potential and anchorage-independent growth of the medulloblastoma cells. Transcriptome analysis was performed to delineate the molecular mechanism underlying reduction in the malignant potential of the medulloblastoma cells upon DDX3X knockdown. Exogenous expression of three DDX3X missense mutants in the DDX3X knockdown cells could restore the malignant potential of the medulloblastoma cells.
2023-03-31 | GSE201967 | GEO
Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.
2016-05-20 | GSE59095 | GEO
Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.
2016-05-20 | GSE59093 | GEO
Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.
2016-05-20 | GSE59094 | GEO
Project description:Paralog dependency analysis of the DDX3X/DDX3Y genes through RNA-seq. Three types of KNS-42 cell lines are used in this experiment: one parental, one with a DDX3X over-expression (codon optimized) and one with DDX3Y over-expression (codon optimized). Targeting of the DDX3X gene is performed with guide RNAs 395 (TGGTACATGCGTATCCTTCA). The negative control is targeting AAVS1/PPP1R12C (AAVS1, GGGGCCACTAGGGACAGGAT). Samples were processed at 7 days after transduction. 3 independent repeats of the experiment were performed.
2022-04-06 | GSE190507 | GEO
Project description:DDX3X is frequently mutated in the WNT and SHH subtypes of medulloblastoma Ð the commonest malignant childhood brain tumor. But whether DDX3X functions as a medulloblastoma oncogene or tumor suppressor gene is not known. Here we show that Ddx3x regulates hindbrain patterning and development by controlling Hox gene expression and cell stress signaling. In mice predisposed to Wnt or Shh-medulloblastoma Ddx3x sensed oncogenic stress and suppressed tumor formation. WNT and SHH-medulloblastomas normally arise only in the lower and upper rhombic lips respectively. Deletion of Ddx3x relived this lineage restriction enabling both medulloblastoma subtypes to arise in either germinal zone. Thus DDX3X is a medulloblastoma tumor suppressor that regulates hindbrain development and restricts the competence of cell lineages to form medulloblastoma subtypes.
2020-03-19 | GSE147069 | GEO
Project description:DDX3X is frequently mutated in the WNT and SHH subtypes of medulloblastoma Ð the commonest malignant childhood brain tumor. But whether DDX3X functions as a medulloblastoma oncogene or tumor suppressor gene is not known. Here we show that Ddx3x regulates hindbrain patterning and development by controlling Hox gene expression and cell stress signaling. In mice predisposed to Wnt or Shh-medulloblastoma Ddx3x sensed oncogenic stress and suppressed tumor formation. WNT and SHH-medulloblastomas normally arise only in the lower and upper rhombic lips respectively. Deletion of Ddx3x relived this lineage restriction enabling both medulloblastoma subtypes to arise in either germinal zone. Thus DDX3X is a medulloblastoma tumor suppressor that regulates hindbrain development and restricts the competence of cell lineages to form medulloblastoma subtypes.
2020-03-19 | GSE147178 | GEO
Project description:The sex chromosome-encoded RNA helicases DDX3X and DDX3Y play important roles in RNA metabolism. Heterozygous mutations of DDX3X frequently occur in cancers and neurodevelopmental disorders which have strong sex biases. However, how different DDX3X variants impair cellular function in sex specific genetic background is not understood. Herein, we found that DDX3X variants with significantly impaired ATPase activities demixed into the shells of unique hollow condensates, the dynamics of which were further differentiated by the RNA binding affinities of the different DDX3X variants. Proteomic and imaging studies revealed that DDX3X variant condensates sequestered wild-type DDX3X, DDX3Y, and other proteins important for various signaling pathways. Intriguingly, wild-type DDX3X improved the dynamics of heterogenous variant/wild-type hollow condensates more than DDX3Y. These results suggest that DDX3X variants with distinct enzymatic and condensation propensities may interact uniquely with wild-type DDX3X or DDX3Y to cause sex-specific cellular impacts.
2022-11-26 | MSV000090789 | MassIVE
Project description:Missense mutations account for nearly 50% of pathogenic mutations in human genetic diseases, most lack effective treatments. Gene therapies, CRISPR-based gene editing, and RNA therapies including transfer RNA (tRNA) modalities are common strategies for potential treatments of genetic diseases. However, reported tRNA therapies are for nonsense mutations, how tRNAs can be engineered to correct missense mutations have not been explored. Here, we describe missense correcting tRNAs (mc-tRNAs) as a potential therapeutic modality for correcting pathogenic missense mutations. Mc-tRNAs are engineered tRNAs that are charged with one amino acid and read codons of another amino acid in translation in human cells. We first developed a series of fluorescence protein (FP)-based reporters that indicate successful correction of missense mutations via restoration of fluorescence signals. We engineered mc-tRNAs that effectively corrected Serine and Arginine missense mutations in the reporters and confirmed the amino acid substitution by protein mass spectrometry and mc-tRNA expression by tRNA sequencing. We examined the transcriptome response to the expression of mc-tRNAs and found some mc-tRNAs induced minimum transcriptomic changes. Furthermore, we applied an Arg-tRNAGln(CUG) mc-tRNA to rescue the autolytic activity of a pathogenic CAPN3 Arg-to-Gln mutant involved in limb-girdle muscular dystrophy type 2A. These results establish a versatile pipeline for mc-tRNA engineering and demonstrate the potential of mc-tRNA as an alternative therapeutic platform for the treatment of genetic disorders.
2024-01-04 | GSE236623 | GEO