Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Liquor fermentation samples

ABSTRACT: liquor fermentation samples Raw sequence reads

PROVIDER: PRJNA1173881 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR31701467_1.fastq.gz	Fastqsanger.gz
	SRR31701467_2.fastq.gz	Fastqsanger.gz
	SRR31701468_1.fastq.gz	Fastqsanger.gz
	SRR31701468_2.fastq.gz	Fastqsanger.gz
	SRR31701469_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 48

Similar Datasets

Liquor brewing wastewater fermentation

Project description:Liquor brewing wastewater fermentation Raw sequence reads

| PRJNA852677 | ENA

light aroma type liquor fermentation metagenome

Project description:light aroma type liquor fermentation metagenome Raw sequence reads

| PRJNA1039311 | ENA

Fermentation samples

Project description:Fermentation samples Raw sequence reads

| PRJNA901247 | ENA

sludge fermentation samples

Project description:sludge fermentation samples Raw sequence reads

| PRJNA891792 | ENA

The first application of biological pretreatment in Chinese spirits, utilizing cellulose-degrading probiotics from Jiangshui to improve the quality of Highland Barely Liquor

Project description:Highland barley liquor is a distilled spirit made from highland barley on the Tibetan Plateau, but its alcohol yield is limited by the high fiber content of the raw material. In the field of biomass resources, functional microorganisms are commonly used in pretreatment to degrade cellulose and other substances, improving fermentation output. In this study, we isolated the cellulose-degrading probiotic Lactobacillus delbrueckii GR-8 (CMCase 6.21 U/mL) from the traditional vegetable-based fermented food "Jiangshui" and applied biological pretreatment to the fermentation of highland barley liquor. During pretreatment, probiotics enhanced cellulase and amylase activities in the fermented grains, resulting in a 25% reduction in cellulose content and a 112% increase in free reducing sugar content. The pretreatment significantly altered the microbial community structure, enhancing microbial diversity. After distillation, alcohol yield increased by 3.5%, and total acid and ester contents rose by 25% and 23%, respectively. Pyrazine compounds increased by 1290%, while higher alcohols like nonanol, phenylethanol, and hexanol decreased. The treated liquor caused less harm to mice, who showed improved memory, motor skills, and lower oxidative liver damage. This study demonstrates that biological pretreatment enhances both fermentation and the quality of Chinese spirits.

2025-03-04 | GSE290678 | GEO

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Fermentation samples

Project description:Fermentation samples Metagenome

| PRJNA801694 | ENA

food fermentation metagenome

Project description:Liquor starter Raw sequence reads

| PRJNA283746 | ENA

Shotgun mass-spectrometry of cerebrospinal fluid (liquor) obtained from patients with vestibular schwannoma

Project description:Cerebrospinal fluid (liquor) samples (N = 44) have been derived from patients with vestibular schwannoma that comprises about 10% of all intracranial tumors. Applying high resolution tandem mass-spectrometry 525 proteins were identified with high confidence (at least 2 peptides per protein, FDR <1%) in the liquor samples. This dataset provides unique information on proteomic composition of vestibular schwannoma liquor samples.

2025-01-16 | PXD037746 | Pride

Fermentation

Project description:Fermentation Raw sequence reads

| PRJNA825322 | ENA