Caenorhabditis elegans
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA143025 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:This SuperSeries is composed of the following subset Series: GSE28561: Genome-wide maps of HLH-1 binding in muscle-enriched embryos. GSE28562: Genome-wide RNA expression in muscle-enriched embryos across different mutations. Refer to individual Series
2012-06-21 | E-GEOD-28563 | biostudies-arrayexpress
Project description:Genome-wide RNA expression in muscle-enriched embryos across different mutations.
| PRJNA143023 | ENA
Project description:To investigate the structure of the bodywall muscle differentiation network, we sought to both identify what role HLH-1 binding has in this regulation. We mapped the relationship between the regulatory targets and HLH-1 binding, as measured by ChIP-seq in animals enriched for bodywall muscle tissue through RNAi feeding. While regulatory targets are enriched for HLH-1 binding, the majority of HLH-1 binding actually occurs away from genes that are affected by hlh-1 loss of function. Nevertheless, HLH-1 binding is associated with both the expected E-box and, near genes belonging to specific regulatory subgroups, novel motifs that may serve as binding sites for cooperative transcription factors. HLH-1 binding genome-wide in the early embryo of C. elegans
2012-06-21 | E-GEOD-28561 | biostudies-arrayexpress
Project description:Replication maps of developing C. elegans embryos.
| PRJNA356401 | ENA
Project description:HLH-1 binding in muscle-enriched embryos and RNA expression in muscle-enriched embryos across different mutations
| PRJNA139037 | ENA
Project description:Background: ; The force generating mechanism of muscle is evolutionarily ancient; the fundamental structural and functional components of the sarcomere are common to motile animals throughout phylogeny. Recent evidence suggests that the transcription factors that regulate muscle development are also conserved. Thus, a comprehensive description of muscle gene expression in a simple model organism should define a basic muscle transcriptome that is also expressed in animals with more complex body plans. To this end, we have applied Micro-Array Profiling of C. elegans (MAPCeL) to muscle cell populations extracted from developing C. elegans embryos. Results: ; Fluorescence Activated Cell Sorting (FACS) was used to isolate myo-3::GFP-positive muscle cells, and their cultured derivatives, from dissociated early C. elegans embryos. Microarray analysis identified 6,693 expressed genes, 1,324 of which are enriched in the myo-3::GFP positive cell population relative to the average embryonic cell. The muscle-enriched gene set was validated by comparisons to known muscle markers, independently derived expression data, and GFP reporters in transgenic strains. These results confirm the utility of MAPCeL for cell type-specific expression profiling and reveal that 60% of these transcripts have human homologs. Conclusions: ; This study provides a comprehensive description of gene expression in developing C. elegans embryonic muscle cells. The finding that over half of these muscle-enriched transcripts encode proteins with human homologs suggests that mutant analysis of these genes in C. elegans could reveal evolutionarily conserved models of muscle gene function with ready application to human muscle pathologies. Experiment Overall Design: Approximately 80 one- and two-cell stage embryos were collected from either heat-shock hlh-1 (KM267) or heat-shock pal-1(JA1179) worms and were incubated for 20 min (hs pal-1) or 60 min (hs hlh-1) at room temperature prior to a heat pulse at 34oC for 30min. After the heat pulse, embryos were incubated at room temperature for 2, 4, and 6 hours (hs hlh-1) or 2, 4, 6, and 8 hours (hs pal-1) prior to total RNA isolation. Embryos were also collected prior to heat shock as a control (0 hour). Triplicate independent samples were prepared for all time points. All hs pal-1 experiments were performed on embryos derived from skn-1, pop-1 double RNAi injected animals. The isolation of total RNA from embryos followed the procedures in (Baugh et al. 2003). Total RNA was used with the Super Smart PCR cDNA synthesis kit (BD Clontech) in 20 cycles with a modified primer (SMART7T27 Primer: 5'-TGAAGCAGTGGTAACAACGCAGAGTAATACGACTCACTATAGGGAGAAGC(T)27VN -3') prior to one cycle target labeling reaction by standard procedures (Affymetrix). Affymetrix C. elegans gene chips (P/N900383, ~22,500 transcript probes) were processed according to manufactures protocol using the NIDDK Genomics Core Laboratory. Microarray data was normalized by MAS5 prior to analysis using GeneSpring software (Silicon Genetics).
2008-06-16 | E-GEOD-8231 | biostudies-arrayexpress
Project description:Background: The force generating mechanism of muscle is evolutionarily ancient; the fundamental structural and functional components of the sarcomere are common to motile animals throughout phylogeny. Recent evidence suggests that the transcription factors that regulate muscle development are also conserved. Thus, a comprehensive description of muscle gene expression in a simple model organism should define a basic muscle transcriptome that is also expressed in animals with more complex body plans. To this end, we have applied Micro-Array Profiling of Caenorhabditis elegans Cells (MAPCeL) to muscle cell populations extracted from developing Caenorhabditis elegans embryos. Results: Fluorescence Activated Cell Sorting (FACS) was used to isolate myo-3::GFP-positive muscle cells, and their cultured derivatives, from dissociated early Caenorhabditis elegans embryos. Microarray analysis identified 6,693 expressed genes, 1,305 of which are enriched in the myo-3::GFP positive cell population relative to the average embryonic cell. The muscle-enriched gene set was validated by comparisons to known muscle markers, independently derived expression data, and GFP reporters in transgenic strains. These results confirm the utility of MAPCeL for cell type-specific expression profiling and reveal that 60% of these transcripts have human homologs. Conclusions: This study provides a comprehensive description of gene expression in developing Caenorhabditis elegans embryonic muscle cells. The finding that over half of these muscle-enriched transcripts encode proteins with human homologs suggests that mutant analysis of these genes in Caenorhabditis elegans could reveal evolutionarily conserved models of muscle gene function with ready application to human muscle pathologies. Keywords: embryonic muscle, myo-3::GFP
2007-07-13 | GSE8462 | GEO
Project description:To investigate the structure of the bodywall muscle differentiation network, we sought to both identify what role HLH-1 binding has in this regulation. We mapped the relationship between the regulatory targets and HLH-1 binding, as measured by ChIP-seq in animals enriched for bodywall muscle tissue through RNAi feeding. While regulatory targets are enriched for HLH-1 binding, the majority of HLH-1 binding actually occurs away from genes that are affected by hlh-1 loss of function. Nevertheless, HLH-1 binding is associated with both the expected E-box and, near genes belonging to specific regulatory subgroups, novel motifs that may serve as binding sites for cooperative transcription factors.
2012-06-22 | GSE28561 | GEO
Project description:Expression data from C. elegans wild type, hlh-25 mutant and hlh-29 mutant strains
| PRJNA273953 | ENA
Project description:Deep sequencing of size-selected DNaseI-treated chromatin (DNase-seq) allows high resolution measurement of chromatin accessibility to DNaseI cleavage, permitting identification of de novo active cis regulatory modules (CRMs) and individual transcription factor (TF) binding sites. We adapted DNase-seq to nuclei isolated from C. elegans embryos and L1 arrest larvae to generate high-resolution maps of TF binding. Over half of embryonic DNaseI hypersensitive sites (DHS) were annotated in noncoding sequences, with 23% in intergenic, 11% promoter regions and 21% in introns, with similar statistics in data collected from L1 arrest larvae. Noncoding DHS exhibit high evolutionary sequence conservation and are enriched in marks of enhancer activity and transcription. We validated noncoding DHS against a previously investigated set of enhancers from myo-2, myo-3, hlh-1, elt-2 and lin-26/lir-1 gene loci and recapitulated 15 of 17 known enhancers in these loci. We then mined the DNase-seq data to identify putative active CRMs and TF footprints. Our DNase-seq data could also be used to improve predictions of tissue-specific expression compared to motifs alone. In a pilot functional test, 10 of 15 DHS from pha-4, icl-1 and ceh-13 drove reporter gene expression in transgenic C. elegans. Overall, we provide experimental annotation of 26,644 putative CRMs in the embryo containing 55,890 TF footprints, and 15,841 putative CRMs in the L1 arrest larvae containing 32,685 TF footprints.
2017-08-01 | GSE97425 | GEO