Project description:Next-Generation-Sequencing (NGS) technologies have led to important improvement in the detection of new or unrecognized infective agents, related to infectious diseases. In this context, NGS high-throughput technology can be used to achieve a comprehensive and unbiased sequencing of the nucleic acids present in a clinical sample (i.e. tissues). Metagenomic shotgun sequencing has emerged as powerful high-throughput approaches to analyze and survey microbial composition in the field of infectious diseases. By directly sequencing millions of nucleic acid molecules in a sample and matching the sequences to those available in databases, pathogens of an infectious disease can be inferred. Despite the large amount of metagenomic shotgun data produced, there is a lack of a comprehensive and easy-use pipeline for data analysis that avoid annoying and complicated bioinformatics steps. Here we present HOME-BIO, a modular and exhaustive pipeline for analysis of biological entity estimation, specific designed for shotgun sequenced clinical samples. HOME-BIO analysis provides comprehensive taxonomy classification by querying different source database and carry out main steps in metagenomic investigation. HOME-BIO is a powerful tool in the hand of biologist without computational experience, which are focused on metagenomic analysis. Its easy-to-use intrinsic characteristic allows users to simply import raw sequenced reads file and obtain taxonomy profile of their samples.
Project description:Next-Generation-Sequencing (NGS) technologies have led to important improvement in the detection of new or unrecognized infective agents, related to infectious diseases. In this context, NGS high-throughput technology can be used to achieve a comprehensive and unbiased sequencing of the nucleic acids present in a clinical sample (i.e. tissues). Metagenomic shotgun sequencing has emerged as powerful high-throughput approaches to analyze and survey microbial composition in the field of infectious diseases. By directly sequencing millions of nucleic acid molecules in a sample and matching the sequences to those available in databases, pathogens of an infectious disease can be inferred. Despite the large amount of metagenomic shotgun data produced, there is a lack of a comprehensive and easy-use pipeline for data analysis that avoid annoying and complicated bioinformatics steps. Here we present HOME-BIO, a modular and exhaustive pipeline for analysis of biological entity estimation, specific designed for shotgun sequenced clinical samples. HOME-BIO analysis provides comprehensive taxonomy classification by querying different source database and carry out main steps in metagenomic investigation. HOME-BIO is a powerful tool in the hand of biologist without computational experience, which are focused on metagenomic analysis. Its easy-to-use intrinsic characteristic allows users to simply import raw sequenced reads file and obtain taxonomy profile of their samples.
Project description:Part of a set of highly integrated epigenome maps for Arabidopsis thaliana. Keywords: Illumina high-throughput bisulfite sequencing Whole genome shotgun bisulfite sequencing of wildtype Arabidopsis plants (Columbia-0), and met1, drm1 drm2 cmt3, and ros1 dml2 dml3 null mutants using the Illumina Genetic Analyzer.
Project description:Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)
Project description:Here we report that the spatial organization of yeast tRNA genes depends upon both locus position and tRNA identity; supporting the idea that the genomic organization of tRNA loci utilizes tRNA dependent signals within the nucleoprotein-tRNA complexes that form into clusters. We use high-throughput sequencing coupled to Circular Chromosome Conformation Capture to detect interactions with two wild type tRNAs and these same positions replaced with suppressor tRNAs (SUP4-1). Detect DNA-DNA interactions (Circular chromosome conformation capture; 4C) with two wild type tRNAs and these same positions replaced with suppressor tRNAs (SUP4-1) Supplementary files: Alignment files generated by Topography v1.19 software.
