Undefined
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB53921 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:High-throughput targeted sequencing to detect gene-edited plants
| PRJEB58426 | ENA
Project description:We aimed to investigate the microbial community composition in patients with intracerebral hemorrhage (ICH) and its effect on prognosis. The relationship between changes in bacterial flora and the prognosis of spontaneous cerebral hemorrhage was studied in two cohort studies. Fecal samples from healthy volunteers and patients with intracerebral hemorrhage were subjected to 16S rRNA sequencing at three time points: T1 (within 24 hours of admission), T2 (3 days post-surgery), and T3 (7 days post-surgery) using Illumina high-throughput sequencing technology.
2024-08-22 | E-MTAB-14351 | biostudies-arrayexpress
Project description:A comparison of high-throughput SARS-CoV-2 sequencing methods using COVID-19 patient samples
| PRJEB52218 | ENA
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Next-Generation-Sequencing (NGS) technologies have led to important improvement in the detection of new or unrecognized infective agents, related to infectious diseases. In this context, NGS high-throughput technology can be used to achieve a comprehensive and unbiased sequencing of the nucleic acids present in a clinical sample (i.e. tissues). Metagenomic shotgun sequencing has emerged as powerful high-throughput approaches to analyze and survey microbial composition in the field of infectious diseases. By directly sequencing millions of nucleic acid molecules in a sample and matching the sequences to those available in databases, pathogens of an infectious disease can be inferred. Despite the large amount of metagenomic shotgun data produced, there is a lack of a comprehensive and easy-use pipeline for data analysis that avoid annoying and complicated bioinformatics steps. Here we present HOME-BIO, a modular and exhaustive pipeline for analysis of biological entity estimation, specific designed for shotgun sequenced clinical samples. HOME-BIO analysis provides comprehensive taxonomy classification by querying different source database and carry out main steps in metagenomic investigation. HOME-BIO is a powerful tool in the hand of biologist without computational experience, which are focused on metagenomic analysis. Its easy-to-use intrinsic characteristic allows users to simply import raw sequenced reads file and obtain taxonomy profile of their samples.
2021-07-26 | E-MTAB-9189 | biostudies-arrayexpress
Project description:Next-Generation-Sequencing (NGS) technologies have led to important improvement in the detection of new or unrecognized infective agents, related to infectious diseases. In this context, NGS high-throughput technology can be used to achieve a comprehensive and unbiased sequencing of the nucleic acids present in a clinical sample (i.e. tissues). Metagenomic shotgun sequencing has emerged as powerful high-throughput approaches to analyze and survey microbial composition in the field of infectious diseases. By directly sequencing millions of nucleic acid molecules in a sample and matching the sequences to those available in databases, pathogens of an infectious disease can be inferred. Despite the large amount of metagenomic shotgun data produced, there is a lack of a comprehensive and easy-use pipeline for data analysis that avoid annoying and complicated bioinformatics steps. Here we present HOME-BIO, a modular and exhaustive pipeline for analysis of biological entity estimation, specific designed for shotgun sequenced clinical samples. HOME-BIO analysis provides comprehensive taxonomy classification by querying different source database and carry out main steps in metagenomic investigation. HOME-BIO is a powerful tool in the hand of biologist without computational experience, which are focused on metagenomic analysis. Its easy-to-use intrinsic characteristic allows users to simply import raw sequenced reads file and obtain taxonomy profile of their samples.
2021-07-26 | E-MTAB-9191 | biostudies-arrayexpress
Project description:H3K56ac profiling in Candida albicans by high throughput sequencing
| PRJEB55818 | ENA
Project description:Interventions: Case vs control:No
Primary outcome(s): High-throughput sequencing
Study Design: Case-Control study
| 2676067 | ecrin-mdr-crc
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO