Project description:To identify differentially regulated genes between wild-type and Pak1 deficient mouse breast cancer cells, we performed a comparative gene profiling study by using mouse whole genome arrays. We compared the gene expression profiles of Her2 positive : Pak1 deficient cells vs Her2 positive : Pak1 wild type cells. All the experiments were performed in duplicate using tumor derived cells from two different tumors per group.
Project description:To identify differentially regulated genes between wild-type and Pak1 deficient mouse breast cancer cells, we performed a comparative gene profiling study by using mouse whole genome arrays.
Project description:To identify differentially phosphorylated proteins between wild-type and Pak1-deficient mouse breast cancer cells, we performed a comparative study by using phospho-antibody arrays.
Project description:To identify differentially regulated genes between wild-type and Pak1 deficient human breast cancer cells, we performed a comparative gene profiling study by using human whole genome arrays.
Project description:To identify differentially regulated genes between wild-type and Pak1 deficient human breast cancer cells, we performed a comparative gene profiling study by using human whole genome arrays. We compared the gene expression profiles of MCF10A.B2 cells (MCF10A cells expressing a chemically activatable form of Her2) stably expressing a Tet inducible shRNA directed against Pak1 gene. All the experiments were performed in duplicate using tumor derived cells from two different tumors per group.
Project description:Pak1 as a serine/threonine kinase, has been implicated in cytoskeletal remodelling, cell motility, apoptosis and transformation. Pak1 plays important roles in multiple signal pathways. Pak1 protects cells from apoptosis through at least three different pathways including forkhead box O1 (FOXO1), B-cell CLL/lymphoma 2 (Bcl-2) and DLC1. Pak1 also regulates activity of Raf and Aurora kinases to affect cellular proliferation. Overexpression of Pak1 is involved in the regulation of actin assembly and disassembly through phosphorylations of LIM Kinase and cytoskeletal associated proteins such as Filamin A, Paxillin, Caldesmon, Cortactin and Arp2/3. Pak1 also regulates microtubule dynamics via activation of tubulin cofactor B (TCoB) and DLC1, and inhibition of stathmin. In spite of a large body of work about the mechanism of Pak1 action in cancer, it remains unknown whether Pak1 signaling could potentially regulate the biology of regulatory miRNAs. This is particularly relevant for gastric cancer because Pak1 can activate many regulators of miRNAs expression in gastric cancer cells including NF-kappaB and ERK, and Pak1 signaling has profound phenotypic effects on the biology of gastric cancer cells. We constructed Pak1 knockdown stable cell lines. The stable Pak1 knockdown gastric cancer BGC823 cells and control cells were performed miRNA chip analysis by CapitalBio company. Gastric cancer BGC823 cells with stable Pak1 knockdown and BGC-823 gastric cancer cells transfected with U6 were used in this experiment. Total RNA was extracted by trizol,Here we use a Capitalbio mammal microRNA V3.0(CapitalBio, Beijing, China) containing 509 well-characterized human, mouse and rat miRNAs and various controls to profile the expression levels of miRNA in 16 and conU6 group.three chip were test in each group, and the procedure was repeated twice.
Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.
