Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Anti-silencing mutants

ABSTRACT: Anti-silencing mutants

PROVIDER: PRJNA299799 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR2813633_1.fastq.gz	Fastqsanger.gz
	SRR2813633_2.fastq.gz	Fastqsanger.gz
	SRR2813634_1.fastq.gz	Fastqsanger.gz
	SRR2813634_2.fastq.gz	Fastqsanger.gz
	SRR2813824_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 22

Similar Datasets

MethlyC-Seq of WT (35S-SUC2) and anti-silencing mutants (arp6-5, pie1-7, h2a.z-2, idm1-9 and ros1-14)

Project description:Using MethylC-Seq to provide single-base resolution of DNA methylation status in 35S-SUC2 WT and anti-silencing mutants( arp6-5, pie1-7, h2a.z-2, idm1-9 and ros1-14）

2024-10-11 | GSE74347 | GEO

silencing mutants-Transcriptome analysis of silencing mutants and endogenous hairpin KO insertion.

Project description:rs09-06_silencing-muntants - silencing mutants - Find endogenous targets of SDE3, SDE5 and IR71. - Lines IR71 KO n°3, smd8#25, sde3 (Col-0), sde5 (Col-0), Suc-SUL(Col-0) and Col-0 were grown for 11 days on MS solid medium, seedlings were then transferred in MS liquid medium and harvested 2.5 days after. Keywords: genotype comparaison

2010-09-15 | GSE23915 | GEO

Anti-silencing mutants

Project description:This SuperSeries is composed of the SubSeries listed below.

2024-10-11 | GSE74349 | GEO

Small RNA-mediated transgenerational silencing of histone genes impairs fertility in piRNA mutants

Project description:PIWI-interacting RNAs (piRNAs) promote fertility in many animals. Yet, whether this is due to their conserved role in repressing repetitive elements (REs) or other functions remains unclear. Here, we show that the progressive loss of fertility in Caenorhabditis elegans lacking piRNAs is not caused by derepression of REs or other piRNA targets, but rather mediated by the epigenetic silencing of all the replicative histone genes. In the absence of piRNAs, downstream components of the piRNA pathway relocalize from germ granules and piRNA targets to histone mRNAs to synthesize antisense small RNAs (sRNAs) and induce transgenerational silencing. Removal of the downstream components of the piRNA pathway is sufficient to restore histone mRNA expression and fertility in piRNA mutants, and the inheritance of histone sRNAs in wild-type worms adversely affects their fertility for multiple generations. We conclude that the transgenerational silencing of histone genes contributes to the progressive loss of fertility in piRNA mutants and that coupling piRNAs and histone silencing may serve to maintain piRNAs production across evolution.

2019-12-11 | PXD012557 | Pride

silencing mutants-Transcriptome analysis of silencing mutants and endogenous hairpin KO insertion.

2010-09-14 | E-GEOD-23915 | biostudies-arrayexpress

Comprehensive analysis of silencing mutants reveals complex regulation of the Arabidopsis methylome.

Project description:Cytosine methylation is involved in various biological processes such as silencing of transposable elements (TEs) and imprinting. Multiple pathways regulate DNA methylation in a sequence specific manner. What factors regulate DNA methylation at a given site in the genome largely remains elusive. Here by generating single nucleotide resolution maps of DNA methylation we have surveyed the effect of mutations in a comprehensive list of genes involved in gene silencing in Arabidopsis. We find that DNA methylation is site-specifically regulated by different factors. Furthermore, we have identified novel regulators of DNA methylation. We have generated a comprehensive resource to further understanding the control of DNA methylation patterning. Whole genome methylation maps of 86 silencing mutants involved in gene silencing and chromatin modifications were generated using BS-seq (Cokus et al., Nature 2008 ).

2013-01-11 | E-GEOD-39901 | biostudies-arrayexpress

Small RNA-mediated transgenerational silencing of histone genes impairs fertility in piRNA mutants (sRNA-Seq)

Project description:PIWI-interacting RNAs (piRNAs) promote fertility in many animals. Yet, whether this is due to their conserved role in repressing repetitive elements (REs) remains unclear. Here, we show that the progressive loss of fertility in Caenorhabditis elegans lacking piRNAs is not caused by derepression of REs or other piRNA targets, but rather mediated by the epigenetic silencing of all the replicative histone genes. In the absence of piRNAs, downstream components of the piRNA pathway relocalize from germ granules and piRNA targets to histone mRNAs to synthesize antisense small RNAs (sRNAs) and induce transgenerational silencing. Removal of the downstream components of the piRNA pathway restores histone mRNA expression and fertility in piRNA mutants, and the inheritance of histone sRNAs in wild-type worms adversely affects their fertility for multiple generations. We conclude that the sRNA-mediated silencing of histone genes impairs fertility of piRNA mutants and may serve to maintain piRNAs across evolution.

2019-12-10 | GSE125600 | GEO

Effects of anti-androgenic compounds on zebrafish insulin mutants

Project description:Effects of anti-androgenic compounds on zebrafish insulin mutants

| PRJEB30451 | ENA

Small RNA-mediated transgenerational silencing of histone genes impairs fertility in piRNA mutants (sRNA-Seq IP)

Project description:PIWI-interacting RNAs (piRNAs) promote fertility in many animals. Yet, whether this is due to their conserved role in repressing repetitive elements (REs) remains unclear. Here, we show that the progressive loss of fertility in Caenorhabditis elegans lacking piRNAs is not caused by derepression of REs or other piRNA targets, but rather mediated by the epigenetic silencing of all the replicative histone genes. In the absence of piRNAs, downstream components of the piRNA pathway relocalize from germ granules and piRNA targets to histone mRNAs to synthesize antisense small RNAs (sRNAs) and induce transgenerational silencing. Removal of the downstream components of the piRNA pathway restores histone mRNA expression and fertility in piRNA mutants, and the inheritance of histone sRNAs in wild-type worms adversely affects their fertility for multiple generations. We conclude that the sRNA-mediated silencing of histone genes impairs fertility of piRNA mutants and may serve to maintain piRNAs across evolution.

2019-12-10 | GSE125598 | GEO

GIM musmusculus anti-Dicer RNAi silencing

Project description:We used the TriFectaTM (IDT, Integrated DNA Technologies,<br><br>Coralville, IA, USA) anti-Dicer RNAi sequence (AGAACGAAAUGCAAGGAAUGGACTCGAGUCCAUUCCUUGCAUUUCGUUCUUC, ACAAGAAACGGAAUCACAUCACACTAGUGUGAUGUGAUUCCGUUUCUUGUCG, GCAGUUGUCCUAAACAGAUUGAUAAUUAUCAAUCUGUUUAGGACAACUGCUG) to silencing Dicer mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 20 nM of each anti-Dicer siRNA using Hiperfect reagent (Qiagen) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by quantitative PCR (qRT-PCR) using the primers 5M-^RCCCAAATGTAGAACCCGAGA 3M-^R forward and 5M-^RCAACCGACACTGTCCATCG 3M-^R reverse, which allowed amplification of a 119 bp PCR product corresponding to a segment of the Dicer mRNA (cDNA). Transcriptional expression levels were determined using a StepOne Real-Time PCR System (Applied Biosystems, USA).

2011-08-30 | E-MEXP-3211 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data