Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

39 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

GIM musmusculus anti-Dicer RNAi silencing

ABSTRACT: We used the TriFectaTM (IDT, Integrated DNA Technologies,

Coralville, IA, USA) anti-Dicer RNAi sequence (AGAACGAAAUGCAAGGAAUGGACTCGAGUCCAUUCCUUGCAUUUCGUUCUUC, ACAAGAAACGGAAUCACAUCACACTAGUGUGAUGUGAUUCCGUUUCUUGUCG, GCAGUUGUCCUAAACAGAUUGAUAAUUAUCAAUCUGUUUAGGACAACUGCUG) to silencing Dicer mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 20 nM of each anti-Dicer siRNA using Hiperfect reagent (Qiagen) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by quantitative PCR (qRT-PCR) using the primers 5M-^RCCCAAATGTAGAACCCGAGA 3M-^R forward and 5M-^RCAACCGACACTGTCCATCG 3M-^R reverse, which allowed amplification of a 119 bp PCR product corresponding to a segment of the Dicer mRNA (cDNA). Transcriptional expression levels were determined using a StepOne Real-Time PCR System (Applied Biosystems, USA).

ORGANISM(S): Mus musculus

SUBMITTER: Geraldo Passos

PROVIDER: E-MEXP-3211 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

GIM mTEC Aire silencing

Project description:We used the TriFectaTM (IDT, Integrated DNA Technologies, Coralville, IA, USA) anti-Aire RNAi sequence (GGAUUCUCUUUAAGGACUACAAUCTAGAUUGUAGUCCUUAAAGAGAAUCCUC) in order to silencing Aire mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 10nM of anti-Aire siRNA using Hiperfect reagent (Qiagen, GmbH, Hilden, Germany) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kitM-. (Ambion, Austin, TX, USA), which served as template for cDNA synthesis. Gene knockdown was confirmed by quantitative reverse transcription PCR (qRT-PCR) using the primers 5_-GCAACTCTGGCCTCAAAGAG-3_ forward and 5_-GGTCTGAATTCCGTTTCCAA-3_ reverse, which allowed amplification of a 120 bp PCR product corresponding to a segment of the Aire cDNA. The cDNA samples were prepared using Superscript II reverse transcriptase (Invitrogen Corporation, Carlsbad, CA, USA) enzyme, as recommended. Expression of the above mentioned genes was quantified using a 7500 Real Time PCR System (Applied Biosystems)

2011-08-31 | E-MEXP-3213 | biostudies-arrayexpress

Transcriptional profile in TECs

Project description:Cortical 1.4C18 and medullary 3.10 TEC lines (mTEC) were cultured in 10% fetal bovine serum-supplemented RPMI 1640 medium at 37 ?C in a 5% CO2 atmosphere. Confluent cultures of 3.10 mTEC cell line were cultured during 72 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kitM-. (Ambion, Austin, TX, USA).

2011-08-31 | E-MEXP-3214 | biostudies-arrayexpress

microRNA expression profile of medullary thymic epithelial cells - mTEC 3.10 strain - submitted of in vitro Aire knockdown - siRNA silencing-

Project description:The oligo microarrays were used to determine microRNA expression profiles of medullary thymic epithelial cells (mTECs) submitted of in vitro Aire Knockdown (siRNA silencing).

2012-08-21 | E-MEXP-3359 | biostudies-arrayexpress

siRNAi profiling of mouse thymus treated with GIM anti-AIRE

Project description:We used the TriFecta TM (IDT, Integrated DNA Technologies, USA) anti-Aire siRNA sequence (GGAUUCUCUUUAAGGACUACAAUCTAGAUUGUAGUCCUUAAAGAGAAUCCUC) to silencing Aire mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 10 nM of anti-Aire siRNA using Hiperfect reagent (Qiagen) following manufacturers instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by semi-quantitative reverse transcription PCR (RT-PCR) using the primers 5prim CATCCTGGATTTCTGGAGGA 3prim forward and 5prim GCTCTTTGAGGCCAGAGTTG 3prim reverse, which allowed amplification of a 253 bp PCR product corresponding to a segment of the Aire mRNA (cDNA). The PCR mix contained 200 uM dNTPs, 1.5 mM MgCl2, 50 mM KCl, 10 mM TRIS-HCl (pH 8.4), 10 uM each primer and 2 U Taq DNA polymerase. The cycling temperature was: 35 x 30 sec each (94oC, 57oC and 72oC). An anti-HPRT siRNA included in this kit but whose sequence was not furnished was used in parallel to evaluate the efficiency of the gene knockdown assay on 3.10 mTEC cell line (data not shown).

2009-08-30 | E-MEXP-2181 | biostudies-arrayexpress

The effect of Dicer knockdown on the transcriptional expression profile of 3.10 mTEC cell line.

Project description:Dicer, also known as endoribonuclease Dicer or helicase with RNase motif, cleaves double-stranded RNA (dsRNA) and pre-microRNA (pre-miRNA) into short mature double-stranded RNA fragments called small interfering RNA and microRNA, respectively. Medullary thymic epithelial cells (mTECs) express close to 90% of the protein-coding genome, besides they play an important role to self-tolerance through the ectopic expression of peripheral tissue antigens (PTAs) in the thymus. MicroRNAs are potent post-transcriptional regulators in developmental switches, lineage commitment and gene expression regulation, but their role in representation of the immunological self in mature mTECs is not fully understood. So we used a Mus musculus mTEC cell line (mTEC 3.10) to knockdown Dicer transcript by means of siRNA transfection and then observe the effect of Dicer knockdown in the transcriptional profile of messenger RNAs (mRNAs) by means of oligo microarray hybridization. The Agilent oligo microarrays were used to determine the large scale mRNA transcriptional profiles of control or Dicer-knockdown 3.10 mTECs.

2016-06-27 | E-MTAB-4628 | biostudies-arrayexpress

The effect of Dicer knockdown on the microRNA transcriptional profile of 3.10 mTEC cell line.

2016-06-27 | E-MTAB-4627 | biostudies-arrayexpress

Transcription profiling of mouse thymus gland from pre-diabetic and diabetic animals.

Project description:Female NOD mice were born in specific pathogen free (SPF) conditions at the CEMIB-UNICAMP animal facility (University of Campinas, Sï¿½o Paulo, Brazil) and maintained in SPF mini-isolators in our laboratory at the University of Sï¿½o Paulo, Campus of Ribeirï¿½o Preto, Brazil. We studied both pre-diabetic (8ï¿½2 week-old) and diabetic (20ï¿½2 week-old) animals. Diabetes was confirmed by blood glucose levels (?250 mg glucose/dL) using the Accu Check ï¿½ Active Kit (Roche Diagnï¿½stica Brasil, Sï¿½o Paulo, Brazil). The thymic stroma was separated from the whole thymus. The mTEC 3.10 medullary thymic epithelial cell line was established from C57BL/6 mice, and the original medullary phenotype was confirmed by immunostaining with anti-cytokeratin monoclonal antibodies. In addition, the CD80+ phenotype was confirmed using fluorescent activated cell sorting (FACS) analysis. Cells were cultured in 10% fetal bovine serum-supplemented RPMI 1640 medium at 37oC and 5% CO2. Total RNA was extracted from 1x107 stromal cells (from pre-diabetic and diabetic animals) and 1x107 mTEC 3.10 cells using Trizolï¿½ Reagent and following the manufacturerï¿½s instructions (Invitrogen, Carlsbad, CA, USA). RNA preparations were confirmed to be free of proteins and phenol using UV spectrophotometry and the state of degradation was assessed using agarose gel electrophoresis (ethidium bromide staining).

2009-11-16 | E-MEXP-2339 | biostudies-arrayexpress

Transcription profiling of mouse thymus glandwfrom normal and ollagen induced arthritis animals

Project description:DBA/1J and DBA-2/J mice (12-14 weeks old) weighing 18ï¿½22 g were housed in temperature-controlled rooms (22ï¿½25ï¿½C) in the animal facility of the School of Medicine of Ribeirï¿½o Preto, University of Sï¿½o Paulo, Sï¿½o Paulo, Brazil, and received water and food ad libitum. DBA/1J and DBA-2/J male mice were used in type II collagen immunizations. For CIA, at day zero, DBA/1J males were intradermally injected at the base of the tail with 200 ï¿½g of bovine type II collagen (CII) (Sigma) in 100ï¿½l of 0.05 M acetic acid emulsified with equal volume of complete Freundï¿½s adjuvant (Chondrex, Redmond, WA). On day 21, a second injection of CII (200 ï¿½g in acetic acid) was given intraperitoneally (i.p). DBA/2J males were also immunized with CII and served as controls. A caliper was used to determine the paw diameter and swelling was determined as the increase in diameter compared to day zero of immunization. The thymic stroma was separated from the whole thymus. The mTEC 3.10 medullary thymic epithelial cell line was established from C57BL/6 mice, and the original medullary phenotype was confirmed by immunostaining with anti-cytokeratin monoclonal antibodies. In addition, the CD80+ phenotype was confirmed using fluorescent activated cell sorting (FACS) analysis. Cells were cultured in 10% fetal bovine serum-supplemented RPMI 1640 medium at 37oC and 5% CO2. Total RNA was extracted from 1x107 stromal cells and from 1x107 mTEC 3.10 cells using Trizolï¿½ Reagent and following the manufacturerï¿½s instructions (Invitrogen, Carlsbad, CA, USA). RNA preparations were confirmed to be free of proteins and phenol using UV spectrophotometry and the state of degradation was assessed using agarose gel electrophoresis (ethidium bromide staining).

2009-10-01 | E-MEXP-2338 | biostudies-arrayexpress

4-HNE modification of human recombinant Dicer

Project description:We used mass spectrometry analysis (nanoLC-MS/MS) to map 4-HNE-modified residues of human Dicer exposed in vitro to 4-HNE in a concentration-dependent maner

2023-11-17 | PXD034113 | Pride

MicroRNAs maintain bivalency in mouse embryonic stem cells [ChIP-seq]

Project description:The protein Dicer is required for microRNA (miRNA) biogenesis, and therefore Dicer-deficient cells lack all mature, functional miRNAs. Here we investigated the binding of the PRC2 component Ezh2 in wildtype and Dicer-deficient mouse embryonic stem cells genomewide using ChIP-sequencing analysis. Examination of Ezh2 binding in mouse ES cells either proficient (wildtype) or deficient (KO) of the protein Dicer

2016-06-02 | E-GEOD-60160 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data