Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Sediment metagenome

ABSTRACT: illumina high-throughput sequencing of 16S rRNA gene

PROVIDER: PRJNA317935 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR3354401_1.fastq.gz	Fastqsanger.gz
	SRR3354401_2.fastq.gz	Fastqsanger.gz
	SRR3354292.fastq.gz	Fastqsanger.gz
	SRR3354353_1.fastq.gz	Fastqsanger.gz
	SRR3354353_2.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 5

Similar Datasets

marine sediment metagenome

Project description:16S rRNA high throughput sequencing of sediment

| PRJNA416963 | ENA

sediment metagenome

Project description:illumina high-throughput sequencing of AOB community

| PRJNA317944 | ENA

sediment metagenome

Project description:Illumina high-throughput sequencing of bacterial community

| PRJNA317947 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Study of Gut Microbiome and Colorectal Tumors

Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.

| 2255499 | ecrin-mdr-crc

Nobiletin ameliorates high fat-induced disruptions in rhythmic glucagon-like peptide-1 secretion - 16S

Project description:16S rRNA gene sequencing of colonic feces from mice fed regular chow, regular chow+nobiletin, high-fat diet or high-fat diet+nobiletin.

2022-05-06 | E-MTAB-11551 | biostudies-arrayexpress

Project description:16S rRNA gene high-throughput sequencing

| PRJNA874856 | ENA

Project description:High-throughput 16S rRNA gene sequencing

| PRJNA1014794 | ENA

Project description:High-throughput 16S rRNA gene sequencing

| PRJNA1014803 | ENA

Project description:16S rRNA gene high-throughput sequencing

| PRJNA1153362 | ENA