Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S amplicon Kongsfjorden

PROVIDER: PRJNA377596 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR5330775_1.fastq.gz	Fastqsanger.gz
	SRR5330775_2.fastq.gz	Fastqsanger.gz
	SRR5330776_1.fastq.gz	Fastqsanger.gz
	SRR5330776_2.fastq.gz	Fastqsanger.gz
	SRR5330777_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 8

Similar Datasets

Experimental tests strongly challenge the evidence of a healthy human blood microbiome

Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.

2024-03-01 | GSE254843 | GEO

Microbial communities in the gut of the beetle Odontotaenius disjunctus

Project description:16S amplicon pool analyses of the four gut sections of the wood-feeding beetle, Odontotaenius disjunctus The beetle is purely wood feeding, and we aim to first characterize the community that exist within the gut sections

2012-08-14 | GSE40067 | GEO

Project description:Kongsfjorden bacterial community from amplicon sequencing

| PRJNA666789 | ENA

Microbial communities in the gut of the beetle Odontotaenius disjunctus

2012-08-13 | E-GEOD-40067 | biostudies-arrayexpress

Soil Metaproteomics LC-MS

Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.

2022-03-01 | PXD009773 | Pride

16S rDNA Amplicon Sequencing Analysis of Polystyrene Microplastic Exposed Zebrafish Intestine

Project description:Microplastics (MPs) as widespread contamination pose high risk for aquatic organisms.Intestinal microbiotahas have high interaction with immune system of host body. In this study, intestinal microbiota of zebrafish after Polystyrene (PS-MPs) exposure were characterized by 16S rDNA amplicon sequencing. We found that 100nm and 200μm PS-MPs exposure significantly increased diversity of intestinal microbiota and all the three sizes of PS-MPs increased abundance of pathogenic bacteria.

2019-10-01 | GSE136108 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

a0d12616-5be0-429c-bd03-670afc18531b - samples

Project description:16S bacterial amplicon sequencing data for Guangzhou cohort

| EGAD00001010268 | EGA

7a75f7bd-831c-4b1a-9a69-e36963fb9e78 - samples

Project description:Amplicon sequencing from 45 samples - Amplicons of 16s v3-v4

| EGAD00001005027 | EGA

Project description:16s amplicon

| PRJNA997451 | ENA