Ontology highlight
ABSTRACT:
PROVIDER: PRJNA383832 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:CRISPR-Cas13 systems have been adapted as versatile toolkits for RNA-related applications. Here we systematically evaluate the performance of several prominent Cas13 family effectors (Cas13a, Cas13b and Cas13d) under lentiviral vectors and reveal surprisingly differential defects and characteristics of these systems. Using RNA immunoprecipitation sequencing, transcriptome profiling, biochemistry analysis and high-throughput CRISPR-Cas13 screening approaches, we determine that each Cas13 system has its intrinsic RNA targets in mammalian cells. Viral process-related host genes can be targeted by Cas13 and affect the production of fertile lentiviral particles, thereby restricting the utility of lentiviral Cas13 systems. Multiple RNase activities of Cas13 are involved in endogenous RNA targeting. Unlike target-induced collateral effect, intrinsic RNA targeting can be specific, target-independent and dynamically tuned by varied states of Cas13 nucleases. Our work not only provides guidance to appropriately utilize lentiviral Cas13 systems, but also raises cautions about intrinsic RNA targeting during Cas13-based basic and therapeutic applications.
2023-10-09 | GSE202898 | GEO
Project description:CRISPR-Cas13 systems have been adapted as versatile toolkits for RNA-related applications. Here we systematically evaluate the performance of several prominent Cas13 family effectors (Cas13a, Cas13b and Cas13d) under lentiviral vectors and reveal surprisingly differential defects and characteristics of these systems. Using RNA immunoprecipitation sequencing, transcriptome profiling, biochemistry analysis and high-throughput CRISPR-Cas13 screening approaches, we determine that each Cas13 system has its intrinsic RNA targets in mammalian cells. Viral process-related host genes can be targeted by Cas13 and affect the production of fertile lentiviral particles, thereby restricting the utility of lentiviral Cas13 systems. Multiple RNase activities of Cas13 are involved in endogenous RNA targeting. Unlike target-induced collateral effect, intrinsic RNA targeting can be specific, target-independent and dynamically tuned by varied states of Cas13 nucleases. Our work not only provides guidance to appropriately utilize lentiviral Cas13 systems, but also raises cautions about intrinsic RNA targeting during Cas13-based basic and therapeutic applications.
2023-10-09 | GSE202841 | GEO
Project description:CRISPR-Cas13 systems have been adapted as versatile toolkits for RNA-related applications. Here we systematically evaluate the performance of several prominent Cas13 family effectors (Cas13a, Cas13b and Cas13d) under lentiviral vectors and reveal surprisingly differential defects and characteristics of these systems. Using RNA immunoprecipitation sequencing, transcriptome profiling, biochemistry analysis and high-throughput CRISPR-Cas13 screening approaches, we determine that each Cas13 system has its intrinsic RNA targets in mammalian cells. Viral process-related host genes can be targeted by Cas13 and affect the production of fertile lentiviral particles, thereby restricting the utility of lentiviral Cas13 systems. Multiple RNase activities of Cas13 are involved in endogenous RNA targeting. Unlike target-induced collateral effect, intrinsic RNA targeting can be specific, target-independent and dynamically tuned by varied states of Cas13 nucleases. Our work not only provides guidance to appropriately utilize lentiviral Cas13 systems, but also raises cautions about intrinsic RNA targeting during Cas13-based basic and therapeutic applications.
2023-10-09 | GSE202838 | GEO
Project description:In this study we analyzed the effects of an altered Cas13a expression in vivo, in presence or absence of ectopically expressed protospacer RNA (plasmid pCV2_SB6), by RNA-sequencing. The genomic modification of the cas13a controlling promoter enables altered expression of cas13a by adding either subinhibitory crystal violet (CV) concentrations (for transcriptional repression of cas13a), or additionally IPTG (for transcriptional induction of cas13a), to the mutant cultures. Transcriptome profiles were compared to corresponding wild type controls.
2024-04-29 | GSE255203 | GEO
Project description:Profiling Cas13a activity targeting influenza virus
| PRJNA476504 | ENA
Project description:We develop a CRISPR-Assisted RNA-Protein Interaction Detection method (CARPID), which leverages CRISPR/CasRx-based RNA targeting and proximity labeling to identify binding proteins of specific lncRNA in the native cellular context.
2020-05-20 | PXD015702 |
Project description:CRISPR-Cas ribonucleoproteins are important tools for gene editing in pre-implantation embryos. However, the inefficient production of biallelic deletions in cattle zygotes has hindered mechanistic studies of gene function. In addition, the presence of maternal RNAs that support embryo development until embryonic genome activation may cause confounding phenotypes. Here, we aimed to improve the efficiency of biallelic deletions and deplete specific maternal RNAs in cattle zygotes by CRISPR-Cas. Two electroporation sessions with Cas9D10A ribonucleoproteins targeting exon1 and the promoter of OCT4 produced biallelic deletions in 91% of the embryos tested. In most cases, the deletions were longer than 1000 nucleotides long. Electroporation of Cas13a ribonucleoproteins prevents the production of the corresponding proteins. We electroporated Cas910A ribonucleoproteins targeting exon 1, including the promoter region, of OCT4 in two sessions with inclusion of Cas13a ribonucleoproteins targeting OCT4 mRNAs in the second session to ablate OCT4 function in cattle embryos. A lack of OCT4 resulted in embryos arresting development prior to blastocyst formation at a greater proportion (7.9%) than controls (30.7%, P<0.001). The few embryos that developed past the morula stage did not form a normal inner cell mass. Transcriptome analysis of single blastocysts, confirmed to lack exon 1 and promoter region of OCT4, revealed a significant (FDR<0.1) reduction in transcript abundance of many genes functionally connected to stemness, including markers of pluripotency (CADHD1, DPPA4, GNL3, RRM2). The results confirm that OCT4 is key regulator of genes that modulate pluripotency and is required to form a functional blastocyst in cattle.
2023-07-08 | GSE236474 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress