Ontology highlight
ABSTRACT:
PROVIDER: PRJNA399726 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR5962310.fastq.gz | Fastqsanger.gz | |||
| SRR5962320.fastq.gz | Fastqsanger.gz | |||
| SRR5962311.fastq.gz | Fastqsanger.gz | |||
| SRR5962321.fastq.gz | Fastqsanger.gz | |||
| SRR5962312.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 18 |
Similar Datasets
Project description:CRISPR-Cas13 systems have been adapted as versatile toolkits for RNA-related applications. Here we systematically evaluate the performance of several prominent Cas13 family effectors (Cas13a, Cas13b and Cas13d) under lentiviral vectors and reveal surprisingly differential defects and characteristics of these systems. Using RNA immunoprecipitation sequencing, transcriptome profiling, biochemistry analysis and high-throughput CRISPR-Cas13 screening approaches, we determine that each Cas13 system has its intrinsic RNA targets in mammalian cells. Viral process-related host genes can be targeted by Cas13 and affect the production of fertile lentiviral particles, thereby restricting the utility of lentiviral Cas13 systems. Multiple RNase activities of Cas13 are involved in endogenous RNA targeting. Unlike target-induced collateral effect, intrinsic RNA targeting can be specific, target-independent and dynamically tuned by varied states of Cas13 nucleases. Our work not only provides guidance to appropriately utilize lentiviral Cas13 systems, but also raises cautions about intrinsic RNA targeting during Cas13-based basic and therapeutic applications.
2023-10-09 | GSE202898 | GEO
Project description:CRISPR-Cas13 systems have been adapted as versatile toolkits for RNA-related applications. Here we systematically evaluate the performance of several prominent Cas13 family effectors (Cas13a, Cas13b and Cas13d) under lentiviral vectors and reveal surprisingly differential defects and characteristics of these systems. Using RNA immunoprecipitation sequencing, transcriptome profiling, biochemistry analysis and high-throughput CRISPR-Cas13 screening approaches, we determine that each Cas13 system has its intrinsic RNA targets in mammalian cells. Viral process-related host genes can be targeted by Cas13 and affect the production of fertile lentiviral particles, thereby restricting the utility of lentiviral Cas13 systems. Multiple RNase activities of Cas13 are involved in endogenous RNA targeting. Unlike target-induced collateral effect, intrinsic RNA targeting can be specific, target-independent and dynamically tuned by varied states of Cas13 nucleases. Our work not only provides guidance to appropriately utilize lentiviral Cas13 systems, but also raises cautions about intrinsic RNA targeting during Cas13-based basic and therapeutic applications.
2023-10-09 | GSE202841 | GEO
Project description:CRISPR-Cas13 systems have been adapted as versatile toolkits for RNA-related applications. Here we systematically evaluate the performance of several prominent Cas13 family effectors (Cas13a, Cas13b and Cas13d) under lentiviral vectors and reveal surprisingly differential defects and characteristics of these systems. Using RNA immunoprecipitation sequencing, transcriptome profiling, biochemistry analysis and high-throughput CRISPR-Cas13 screening approaches, we determine that each Cas13 system has its intrinsic RNA targets in mammalian cells. Viral process-related host genes can be targeted by Cas13 and affect the production of fertile lentiviral particles, thereby restricting the utility of lentiviral Cas13 systems. Multiple RNase activities of Cas13 are involved in endogenous RNA targeting. Unlike target-induced collateral effect, intrinsic RNA targeting can be specific, target-independent and dynamically tuned by varied states of Cas13 nucleases. Our work not only provides guidance to appropriately utilize lentiviral Cas13 systems, but also raises cautions about intrinsic RNA targeting during Cas13-based basic and therapeutic applications.
2023-10-09 | GSE202838 | GEO
Project description:In this study we analyzed the effects of an altered Cas13a expression in vivo, in presence or absence of ectopically expressed protospacer RNA (plasmid pCV2_SB6), by RNA-sequencing. The genomic modification of the cas13a controlling promoter enables altered expression of cas13a by adding either subinhibitory crystal violet (CV) concentrations (for transcriptional repression of cas13a), or additionally IPTG (for transcriptional induction of cas13a), to the mutant cultures. Transcriptome profiles were compared to corresponding wild type controls.
2024-04-29 | GSE255203 | GEO
Project description:Profiling Cas13a activity targeting influenza virus
| PRJNA476504 | ENA
Project description:The study investigates how varying target expression levels influences self-targeting and defense using Cas13a. We see how immunity is activated only over a target transcription threshold, which is variable between targets. A gRNA library targeting transcripts from the whole coding genome of E. coli MG1655 confirms the importance of the transcription threshold in determining immunity and shows that most of the cellular transcripts do not induce cytotoxicity.
2022-06-08 | GSE179914 | GEO
Project description:The study investigates how varying target expression levels influences self-targeting and defense using Cas13a. We see how immunity is activated only over a target transcription threshold, which is variable between targets. A gRNA library targeting transcripts from the whole coding genome of E. coli MG1655 confirms the importance of the transcription threshold in determining immunity and shows that most of the cellular transcripts do not induce cytotoxicity.
2022-06-08 | GSE179913 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress