Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S amplicon sequencing of KB-1 dechlorinating cultures

PROVIDER: PRJNA396905 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR5892560.fastq.gz	Fastqsanger.gz
	SRR5892561.fastq.gz	Fastqsanger.gz
	SRR5892562.fastq.gz	Fastqsanger.gz
	SRR5892563.fastq.gz	Fastqsanger.gz
	SRR5892558.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 6

Similar Datasets

Project description:Amplicon sequencing targeting the 16S rRNA gene in dechlorinating cultures at low pH

| PRJNA1007450 | ENA

Project description:Amplicon sequencing targeting the 16S rRNA gene in dechlorinating cultures at low pH

| PRJNA1004986 | ENA

Quantification of mock microbial communities with metagenomes, 16S rRNA gene amplicons and metaproteomics

Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.

2017-05-12 | PXD006118 | Pride

Experimental tests strongly challenge the evidence of a healthy human blood microbiome

Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.

2024-03-01 | GSE254843 | GEO

Characterization of four TCE-dechlorinating microbial enrichments grown with different cobalamin stress and methanogenic conditions

Project description:Four stable and robust TCE-dechlorinating microbial communities were enriched from TCE-contaminated groundwater under four different conditions exploring two parameters, high and low methanogenic activity (Meth and NoMeth), with and without vitamin B12 supplement (MethB12 and NoMethB12, Meth and NoMeth, respectively). Identical amounts of lactate (2.7 mmol) and TCE (20 μl) were supplied as electron donor and electron acceptor. All four cultures were capable of reductively dechlorinating TCE to VC and ethene. Genomic DNA of the four enrichments was applied on a quad-Dhc-genome microarray in order to characterize the gene content of Dehalococcoides species present in the four enrichments

2013-06-30 | GSE33530 | GEO

Soil Metaproteomics LC-MS

Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.

2022-03-01 | PXD009773 | Pride

dechlorinating enrichment culture KB-1

Project description:dechlorinating enrichment culture KB-1 overview

| PRJNA155381 | ENA

Project description:Amplicon sequencing targeting the 16S rRNA gene in a dechlorinating culture

| PRJNA1005046 | ENA

Characterization of four TCE-dechlorinating microbial enrichments grown with different cobalamin stress and methanogenic conditions

Project description:Four stable and robust TCE-dechlorinating microbial communities were enriched from TCE-contaminated groundwater under four different conditions exploring two parameters, high and low methanogenic activity (Meth and NoMeth), with and without vitamin B12 supplement (MethB12 and NoMethB12, Meth and NoMeth, respectively). Identical amounts of lactate (2.7 mmol) and TCE (20 M-NM-<l) were supplied as electron donor and electron acceptor. All four cultures were capable of reductively dechlorinating TCE to VC and ethene. Genomic DNA of the four enrichments was applied on a quad-Dhc-genome microarray in order to characterize the gene content of Dehalococcoides species present in the four enrichments The genomic DNA of four enrichment cultures completely dechlorinated TCE to VC and ethene was used on the microarray to query Dehalococcoides species present in the mixed cultures.

2013-06-30 | E-GEOD-33530 | biostudies-arrayexpress

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data