Ontology highlight
ABSTRACT:
PROVIDER: PRJNA419663 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR6320970_1.fastq.gz | Fastqsanger.gz | |||
| SRR6320970_2.fastq.gz | Fastqsanger.gz | |||
| SRR6320980_1.fastq.gz | Fastqsanger.gz | |||
| SRR6320980_2.fastq.gz | Fastqsanger.gz | |||
| SRR6320990_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 206 |
Similar Datasets
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM). Examination of dmCas9 binding sites using two Trp53 targeting sgRNAs in Arf -/- MEF cell line (mouse).
2014-08-29 | E-GEOD-57650 | biostudies-arrayexpress
Project description:APOBEC-AID family of cytidine deaminase prefers single-stranded nucleic acids for cytidine to uracil deamination. Single-stranded nucleic acids are commonly involved in the DNA repair system for breaks generated by CRISPR-Cas9. Here, we show in human cells that APOBEC3s can trigger the cytidine deamination of single-stranded oligodeoxynucleotides, which ultimately results in base substitution mutations in genomic DNA through the homology-directed repair (HDR) of Cas9-generated double-strand breaks . In addition, the APOBEC3-catalyzed deamination in genomic single-stranded DNA formed during the repair of Cas9 nickase-generated single-strand breaks can be further processed to yield mutations mainly involving insertions or deletions (indels). Mechanistically, both APOBEC3-mediated deamination and DNA repair proteins play important roles in the generation of these indels. Correspondingly, optimizing conditions for the repair of CRISPR-Cas9-generated DNA breaks, such as using double-stranded donors in HDR or temporarily suppressing endogenous APOBEC3s, can substantially repress these unwanted mutations in genomic DNA.
2017-11-10 | GSE105146 | GEO
Project description:CRISPR-Cas immune systems function to defend prokaryotes against potentially harmful mobile genetic elements including viruses and plasmids. The multiple CRISPR-Cas systems (Types I, II, III) each recognize and target destruction of foreign invader nucleic acids via structurally and functionally diverse effector complexes (crRNPs). CRISPR-Cas effector complexes are comprised of CRISPR RNAs (crRNAs) that contain sequences homologous to the invading nucleic acids and Cas proteins specific to each immune system type. We have previously characterized a crRNP in Pyrococcus furiosus (Pfu) that contains Cmr proteins (Type III-B) associated with one of two primary size forms of crRNAs and functions through homology-dependent cleavage of target RNAs. In the current study, we have isolated and characterized two additional native Pfu CRISPR-Cas complexes containing either Csa (Type I-A) or Cst (Type I-G) proteins and distinct profiles of associated crRNAs. For each complex, the Cas proteins were identified by tandem mass spectrometry and immunoblotting and the crRNAs by RNA deep sequencing and Northern blot analysis. The crRNAs associated with both the Csa and Cst complexes originate from each of seven total CRISPR loci and contain identical 5’ ends (8-nt CRISPR RNA repeat-derived 5’ tag sequences) but heterogeneous 3’ ends (containing variable amounts of downstream repeat sequences). These crRNA forms are distinct from Cmr-associated crRNAs, indicating different 3’ end processing pathways following primary cleavage of common pre-crRNAs. We predict that the newly identified Pfu Type I-A (Csa) and Type I-G (Cst)-containing crRNPs, like other previously characterized Type I CRISPR-Cas effector complexes, each function by carrying out crRNA-guided DNA targeting of invading mobile genetic elements. Taken together, our in-depth characterization of the three isolated native complexes provides clear evidence for three compositionally distinct crRNPs containing either Cmr, Csa, or Cst Cas proteins that together make up an impressive arsenal of CRISPR-Cas defense for a single organism. 4 Samples: Protein-associated small RNAs
2015-07-10 | E-GEOD-65781 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage.
2015-03-04 | GSE61099 | GEO
Project description:RNA-guided genome editing with the CRISPR-Cas9 system has great potential for basic and clinical research, but the determinants of targeting specificity and the extent of off-target cleavage remain insufficiently understood. Using chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq), we mapped genome-wide binding sites of catalytically inactive Cas9 (dCas9) in HEK293T cells, in combination with 12 different single guide RNAs (sgRNAs). The number of off-target sites bound by dCas9 varied from ~10 to >1,000 depending on the sgRNA. Analysis of off-target binding sites showed the importance of the PAM-proximal region of the sgRNA guiding sequence and that dCas9 binding sites are enriched in open chromatin regions. When targeted with catalytically active Cas9, some off-target binding sites had indels above background levels in a region around the ChIP-seq peak, but generally at lower rates than the on-target sites. Our results elucidate major determinants of Cas9 targeting, and we show that ChIP-seq allows unbiased detection of Cas9 binding sites genome-wide 1.sgRNA1-6 binding sites were identified with ChipSeq by using HA antibody (there are 2 replicates for sgRNA1-3, one sample for sgRNA4-6,one control without sgRNA) 2.PCR products which amplifies " off-target genomic sites" were deep sequenced in the presence of WT Cas9+sgRNA or WT Cas9 alone( unique adaptor was used for each sgRNA and mixed for multiplex run)
2014-05-18 | E-GEOD-55887 | biostudies-arrayexpress
Project description:The bacterial CRISPR-Cas9 system has been widely adapted for RNA-guided genome editing and gene regulation in diverse organisms yet its in vivo target specificity is poorly understood. Here we provide the first genome-wide binding maps of nuclease-deactivated Cas9 loaded with guide RNAs in mammalian cells. We find a 5-nucleotide seed region in the guide RNA targets Cas9 to thousands of sites in the genome. Chromatin accessibility limits binding to the other hundreds of thousands sites with matching seed sequences, and consequently 70% of off-target binding sites are associated with genes. U-rich seeds have low numbers of off-target sites limited by both low guide RNA abundance and scarcity of complimentary sites in accessible chromatin. Unexpectedly, off-target sites show little evidence of cleavage, supporting a two-state model reminiscent of eukaryotic RNAi machinery where a short seed match triggers binding but extensive pairing is required for cleavage. ChIP-seq of HA-dCas9 loaded with 4 sgRNAs (Phc1-sg1, Phc1-sg2, Nanog-sg2, and Nanog-sg3) in mouse, and 2 sgRNAs in human (EMX1-sg1 and EMX1-sg3)
2014-04-20 | E-GEOD-54745 | biostudies-arrayexpress
Project description:Noncoding RNAs (ncRNAs) comprise an important class of natural regulators that mediate a vast array of biological processes, including the modulation of chromatin architecture. Moreover, artificial ncRNAs have revealed that the functional capabilities of RNA are extremely broad. To further investigate and harness these capabilities, we developed CRISPR-Display ("CRISP-Disp"), a targeted localization strategy that uses Cas9 to deploy large RNA cargos to specific DNA loci. We demonstrate that exogenous RNA domains can be functionally appended onto the CRISPR scaffold at multiple insertion points, allowing the construction of Cas9 complexes with RNAs nearing one kilobase in length, with structured RNAs, protein-binding cassettes, artificial aptamers and pools of random sequences. CRISP-Disp also allows the simultaneous multiplexing of disparate functions at multiple targets. We anticipate that this technology will provide a powerful method with which to ectopically localize functional RNAs and ribonuceloprotein complexes at specified genomic loci. RNA Immunoprecipitation (RIP) against FLAG-tagged Cas9 protein, coexpressed with a large pool of CRISPR RNAs bearing random internal insertions
2015-05-11 | E-GEOD-62305 | biostudies-arrayexpress
Project description:The expression level of microRNAs in FLT3-ITD+ AML is unknown. Using empty vector (EV) lentiviral CRISPR-Cas9 infected FLT3-ITD+ AML cell lines (MV4-11 cells), we performed next generation RNA sequencing on small RNAs to determine microRNA expression level in these cells. We found a variety of evolutionarily conserved and non-conserved microRNAs expressed in our cells of interest. Small RNAseq on EV lentiviral CRISPR-Cas9 infected MV4-11 cell lines was performed on triplicate cultures.
2016-07-01 | E-GEOD-71543 | biostudies-arrayexpress
Project description:We used ChIP-seq to map binding of the CRISPR surveillance complex, Cascade, in a Salmonella enterica serovar Typhimurium strain lacking the gene encoding the endonuclease Cas3. We performed ChIP-seq in strains with wild-type and mutant sequences upstream of the two CRISPR arrays, and in strains with wild-type and mutant nusE genes to determine the impact of Nus factor antitermination on CRISPR array function.
2018-10-13 | E-MTAB-7242 | biostudies-arrayexpress