Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptomic analysis of myosin IIa-deficient B cells

ABSTRACT: Transcriptomic analysis of myosin IIa-deficient B cells

PROVIDER: PRJNA450071 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR6998450_1.fastq.gz	Fastqsanger.gz
	SRR6998450_2.fastq.gz	Fastqsanger.gz
	SRR6998445_1.fastq.gz	Fastqsanger.gz
	SRR6998445_2.fastq.gz	Fastqsanger.gz
	SRR6998446_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 12

Similar Datasets

Transcriptomic analysis of myosin IIa-deficient B cells

Project description:Myosin IIa-deficient follicular B cells have a hyperactivated phenotype. To identify what pathways are regulated by myosin IIa, we performed RNA-seq of coding RNA on flow cytometry sorted follicular B cells from CD23Cre+Myh9fl/fl and CD23Cre+Myh9wt/fl mice.

2018-04-14 | GSE113114 | GEO

Borg5/Cdc42EP curbs Septin dependent stress fiber formation by antagonizing alpha Actinin 4 and Myosin IIA

Project description:The Borg5/Cdc42EP family comprises septin binding proteins, which are known to participate in septin-dependent stress fiber formation. We show here that epithelial Borg5/Cdc42Ep1 restrains stress fibers instead. Borg5 decorates septin filament-aligned thin F-actin filaments under the nucleus of MDCK cells, which in Borg5 depleted cells are replaced by thick stellate stress fibers. These associate with either cell-substratum- or cell-cell- adhesions, increasing tension on E-cadherin based junctions and causing MDCK cells to undergo collective streaming. We identified two known septin partners, Myosin-IIA and alpha Actinin 4 (ACTN4), among proteins that co isolated with Borg5 from MDCK lysates. We found that Borg5 binds Myosin-IIA and ACTN4 directly and negatively regulates their F-actin association. Since both septin partners along with Septins 2 and 9 were furthermore required for the Borg5 depletion-induced F actin phenotype, we propose that Borg5 prevents stellate stress fiber formation by counteracting septin dependent ACTN4 and Myosin IIA activities. The mass spectrometry raw files and search results for Borg 5 affinity purifications are deposited here.

| MSV000092958 | MassIVE

Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools

Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.

2023-12-18 | GSE202685 | GEO

Knocking out non-muscle myosin II in retinal ganglion cells promotes long-distance optic nerve regeneration (RNA-Seq II)

Project description:In addition to altered gene expression, pathological cytoskeletal dynamics in the axon are another key intrinsic barrier for axon regeneration in the central nervous system (CNS). Here we showed that knocking out myosin IIA/B in retinal ganglion cells alone either before or after optic nerve crush induced significant optic nerve regeneration. Combined Lin28a overexpression and myosin IIA/B knockout led to additive promoting effect and long-distance axon regeneration. Immunostaining, RNA sequencing and western blot analyses revealed that myosin II deletion did not affect known axon regeneration signaling pathways or the expression of regeneration associated genes. Instead, it abolished the retraction bulb formation and significantly enhanced the axon extension efficiency. The study provided clear evidence that directly targeting neuronal cytoskeleton was sufficient to induce significant CNS axon regeneration, and combining altered gene expression in the soma and modified cytoskeletal dynamics in the axon was a promising approach for long-distance CNS axon regeneration

2020-03-24 | GSE147400 | GEO

Knocking out non-muscle myosin II in retinal ganglion cells promotes long-distance optic nerve regeneration (RNA-Seq I)

2020-03-22 | GSE147328 | GEO

Transcriptomic analysis of NF2 deficient AB12 cells

Project description:Transcriptomic analysis of NF2 deficient AB12 cells

| PRJNA658530 | ENA

Identification of myosin heavy chain post-translational modifications in patients with MHY mutations

Project description:Congenital myopathies are rare genetic muscle diseases notably due to mutations in the MYH2 gene. Here we assessed their myosin heavy chain post-translational modifications. For that, we purified beta/slow and type IIa myosin heavy chains from limb muscles of five patients and five healthy controls. We then ran a LC/MS analysis.

2023-01-30 | PXD039178 | Pride

Effects of resistance exercise on the transcriptome in MHC I and MHC IIa muscle fibers of young and old women

Project description:Global microarray (HG U133 Plus 2.0) was used for the first time to investigate the effects of resistance exercise on the transcriptome in slow-twitch myosin heavy chain (MHC) I and fast-twitch MHC IIa muscle fibers of young and old women. Vastus lateralis muscle biopsies were obtained pre and 4hrs post resistance exercise in the beginning (untrained state) and at the end (trained state) of a 12 wk progressive resistance training program. A total of 14 females were included in this investigation. The participants included 8 young (23±2y) and 6 old (85±1y) females. All subjects participated in 12 wks of progressive resistance training consisting of bilateral knee extensions with 3x10 reps at 70% of 1-RM, and 3d/wk for a total of 36 training sessions. Vastus lateralis biopsies were obtained in conjunction with the 1st and 36th (last) training session and included a basal biopsy and another biopsy 4hrs post the resistance exercise session. From each biopsy sample, we isolated individual muscle fibers. After myosin isoform identification of isolated fibers (SDS-PAGE), RNA extraction of 20 MHC I and 20 MHC IIa muscle fibers per biopsy sample followed. Thus, each resulting sample contained total RNA from 20 muscle fibers of identical fiber type (MHC I or MHC IIa). A total of 70 samples were analyzed on separate microarray chips, and samples were not pooled between subjects. The study design allowed us to examine the acute effects of resistance exercise on the transcriptome in MHC I and MHC IIa muscle fibers in the untrained and trained state.

2012-02-21 | E-GEOD-28392 | biostudies-arrayexpress

Myosin IIA deficient cells migrate efficiently despite reduced traction forces at cell periphery.

Project description:Cell motility is a cornerstone of embryogenesis, tissue remodeling and repair, and cancer cell invasion. It is generally thought that migrating cells grab and exert traction force onto the extracellular matrix in order to pull the cell body forward. While previous studies have shown that myosin II deficient cells migrate efficiently, whether these cells exert traction forces during cell migration in the absence of the major contractile machinery is currently unknown. Using an array of micron-sized pillars as a force sensor and shRNA specific to each myosin II isoform (A and B), we analyzed how myosin IIA and IIB individually regulate cell migration and traction force generation. Myosin IIA and IIB localized preferentially to the leading edge where traction force was greatest, and the trailing edge, respectively. When individual myosin II isoforms were depleted by shRNA, myosin IIA deficient cells lost actin stress fibers and focal adhesions, whereas myosin IIB deficient cells maintained similar actin organization and focal adhesions as wild-type cells. Interestingly, myosin IIA deficient cells migrated faster than wild-type or myosin IIB deficient cells on both a rigid surface and a pillar array, yet myosin IIA deficient cells exerted significantly less traction force at the leading edge than wild-type or myosin IIB deficient cells. These results suggest that, in the absence of myosin IIA mediated force-generating machinery, cells move with minimal traction forces at the cell periphery, thus demonstrating the remarkable ability of cells to adapt and migrate.

| S-EPMC3625864 | biostudies-literature

Effects of lifelong exercise and age on transcriptome dynamics in MHC I and MHC IIa muscle fibers at baseline and in response to resistance exercise

Project description:RNA-Seq was used for the first time to investigate the effects of resistance exercise on transcriptome dynamics in slow myosin heavy chain (MHC) I and fast MHC IIa muscle fibers among 3 groups of men. Vastus lateralis muscle biopsies were obtained before and 4 hours after resistance exercise.

2024-01-08 | GSE235781 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data