Ontology highlight
ABSTRACT:
PROVIDER: PRJNA474044 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR7244578.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 1 of 1 |
Similar Datasets
Project description:Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)
2022-01-14 | E-MTAB-4946 | biostudies-arrayexpress
Project description:Comparison of translation efficiency in S. cerevisiae, S. paradoxus, and their F1 hybrid. SRA submission number SRP028552; BioProject number PRJNA213844; Ribosome profiling was used to compare mRNA abundance, ribosome occupancy, and translation efficiency in two yeast species and their F1 hybrid.
2013-12-04 | E-GEOD-52119 | biostudies-arrayexpress
Project description:Heritable differences in gene expression between individuals are an important source of phenotypic variation. The question of how closely the effects of genetic variation on protein levels mirror those on mRNA levels remains open. Here, we addressed this question by using ribosomal footprinting to examine how genetic differences between two strains of the yeast S. cerevisiae affect translation. Strain differences in translation were observed for hundreds of genes, more than half as many as showed genetic differences in mRNA levels. Similarly, allele specific measurements in the diploid hybrid between the two strains found roughly half as many cis-acting effects on translation as were observed for mRNA levels. In both the parents and the hybrid, strong effects on translation were rare, such that the direction of an mRNA difference was typically reflected in a concordant footprint difference. The relative importance of cis and trans acting variation on footprint levels was similar to that for mRNA levels. Across all expressed genes, there was a tendency for translation to more often reinforce than buffer mRNA differences, resulting in footprint differences with greater magnitudes than the mRNA differences. Finally, we catalogued instances of premature translation termination in the two yeast strains. Overall, genetic variation clearly influences translation, but primarily does so by subtly modulating differences in mRNA levels. Translation does not appear to create strong discrepancies between genetic influences on mRNA and protein levels. Ribsosomal footprinting and RNASeq in the two yeast strains BY and RM as well as their diploid hybrid. We generated one library each for the BY and RM parents, and two libraries (biological replicates) for the hybrid data.
2014-03-31 | E-GEOD-55400 | biostudies-arrayexpress
Project description:We measured mRNA levels of two yeast species (S.cerevisiae and S.paradoxus) and their hybrid, at four time-points (0, 20min, 40min, 60min) following transcription arrest using 1,10-Phenantroline (150ug/ml). This data was used to infer mRNA degradation rates of orthologous genes, study the divergence of mRNA degradation rates and the contribution of cis and trans mutations.
2011-08-01 | GSE28849 | GEO
Project description:We measured mRNA levels of two yeast species (S.cerevisiae and S.paradoxus) and their hybrid, at four time-points (0, 20min, 40min, 60min) following transcription arrest using 1,10-Phenantroline (150ug/ml). This data was used to infer mRNA degradation rates of orthologous genes, study the divergence of mRNA degradation rates and the contribution of cis and trans mutations. For each of the two biological repeats and each of the four time point, poly(A) mRNAs of the two species was pooled and labeled with cy3 while hybrid poly(A) mRNA was labeled with cy5 and these were hybridized to our custom two-species microarray (Agilent) with four subarrays.
2011-07-31 | E-GEOD-28849 | biostudies-arrayexpress
Project description:Genomic surveys of yeast hybrid species isolated from the wild and from human-related environment, aimed at the reconstruction of the natural evolution of Saccharomyces spp. evolution
2016-04-30 | E-SYBR-11 | biostudies-arrayexpress
Project description:Heritable differences in gene expression between individuals are an important source of phenotypic variation. The question of how closely the effects of genetic variation on protein levels mirror those on mRNA levels remains open. Here, we addressed this question by using ribosomal footprinting to examine how genetic differences between two strains of the yeast S. cerevisiae affect translation. Strain differences in translation were observed for hundreds of genes, more than half as many as showed genetic differences in mRNA levels. Similarly, allele specific measurements in the diploid hybrid between the two strains found roughly half as many cis-acting effects on translation as were observed for mRNA levels. In both the parents and the hybrid, strong effects on translation were rare, such that the direction of an mRNA difference was typically reflected in a concordant footprint difference. The relative importance of cis and trans acting variation on footprint levels was similar to that for mRNA levels. Across all expressed genes, there was a tendency for translation to more often reinforce than buffer mRNA differences, resulting in footprint differences with greater magnitudes than the mRNA differences. Finally, we catalogued instances of premature translation termination in the two yeast strains. Overall, genetic variation clearly influences translation, but primarily does so by subtly modulating differences in mRNA levels. Translation does not appear to create strong discrepancies between genetic influences on mRNA and protein levels.
2014-03-31 | GSE55400 | GEO
Project description:The aim of this project was to evaluate the ploidy of a S. cerevisiae *S. kudriavzevii hybrid in comparison to the lab strain S288C. Other wine yeast have been icluded in the project for the global analysis.
2012-02-09 | GSE31703 | GEO