Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

The roles of duplication and divergence in the evolution of a transcription factor

ABSTRACT: The roles of duplication and divergence in the evolution of a transcription factor

PROVIDER: PRJNA488573 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR7767670_1.fastq.gz	Fastqsanger.gz
	SRR7767670_2.fastq.gz	Fastqsanger.gz
	SRR7767680_1.fastq.gz	Fastqsanger.gz
	SRR7767680_2.fastq.gz	Fastqsanger.gz
	SRR7767690_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 256

Similar Datasets

Regulatory divergence during limb evolution

Project description:Regulatory divergence during limb evolution

| PRJNA521485 | ENA

The roles of duplication and divergence in the evolution of a transcription factor

Project description:This SuperSeries is composed of the SubSeries listed below.

2020-08-29 | GSE119238 | GEO

Regulatory divergence during mouse limb evolution

Project description:Regulatory divergence during mouse limb evolution

| PRJNA521487 | ENA

Regulatory divergence during pig limb evolution

Project description:Regulatory divergence during pig limb evolution

| PRJNA521488 | ENA

Divergence among rice cultivars reveals roles for transposition and epimutation in ongoing evolution of genomic imprinting

Project description:To understand the evolution of imprinting mechanisms in the rice species Oryza sativa, we analyzed DNA methylation, transcription and small RNA expression in embryo and endosperm. Cultivars chosen to represent the genetic diversity of cultivated Oryza sativa comprised Nipponbare and Kitaake of the japonica subspecies, and IR64 and 93-11 cultivars of the indica subspecies. While imprinted expression is generally conserved among rice cultivars, approximately 10% of imprinted genes show imprinting divergence across the four cultivars. Analyses of DNA methylation and small RNAs revealed that small RNA producing loci are closely associated with genic regions and four times more likely to be imprinted than genes. However, imprinting divergence most often correlated with DNA methylation epimutations. Correlative epialleles were largely stable within subspecies. Small indels and transposable element insertions were found at half of the epimutated loci and associated with imprinting divergence at half of the remaining loci. Correlating epigenetic and genetic variation occurred at key regulatory regions – the promoter and transcription start site of maternally-biased genes, and the promoter and gene body of paternally-biased genes. Our results reinforce models for the role of maternal-specific DNA hypomethylation in imprint formation at both maternally and paternally biased genes, and highlight the role of transposition events and epimutation in rice imprinting evolution.

2021-06-29 | GSE130122 | GEO

Divergence among rice cultivars reveals roles for transposition and epimutation in ongoing evolution of genomic imprinting

Project description:Divergence among rice cultivars reveals roles for transposition and epimutation in ongoing evolution of genomic imprinting

| PRJNA534034 | ENA

Heart Chamber Evolution Reveals Roles of Gene/Genome Duplications on Continuous Character Evolution in Vertebrates

Project description:We sequenced at mRNA level in adult hearts of zebrafish, pamprey and sea squirt. Combined with other 11 vertebrate heart RNA-Seq data online, we conducted comprehensive evolutionary genomic analyses to address the contribution of gene/genome duplications on heart structure evolution. We observed that number of duplicate genes expressed in heart increased gradually with the increase of heart chamber number along the vertebrate phylogeny, despite that most of them were duplicated at the time near to the origin of vertebrates or more ancient. Our research provides a clear-cut example to show the relationship among gene duplication, continuous character evolution like heart structure evolution and nature selection.

2018-09-28 | GSE73522 | GEO

Human-chimpanzee hybrid cells reveal gene regulatory evolution underlying skeletal divergence

Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study divergent gene expression separating these species. The hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for non-genetic factors that often confound comparative studies. We differentiated these cells into cranial neural crest cells (CNCCs), the primary cell type giving rise to the face, and used the hybrid cells to generate a catalogue of divergent cis-regulatory gene expression between humans and chimpanzees. We found that cis-regulatory divergence is tightly linked to phenotypic divergence, enabling the identification of candidate genes associated with several divergent traits. Specifically, we find support for lineage-specific selection acting on the cis-regulation of the hedgehog signaling pathway. This pathway includes EVC2 (LIMBIN), whose cis-regulation is among the most divergent in the genome, resulting in 6-fold down-regulation along the human lineage. We found that inducing a similar reduction in EVC2 levels substantially reduces Hh signaling output. Mice and humans lacking functional EVC2 show striking parallels to many human-chimpanzee phenotypic differences, particularly in the skull and face, suggesting that the regulatory divergence of Hh signaling may have contributed to the unique craniofacial morphology of humans. In sum, our results suggest that human-chimpanzee hybrid cells can serve as a valuable resource to study the evolution of gene regulation and its impact on phenotypic divergence. SRA/fastq files include Illumina adapters (GATCGGAAGAGCACACGTCT and GATCGGAAGAGCGTCGTGTA).

2020-10-09 | GSE146481 | GEO

The evolution of expression divergence in wild C. elegans

Project description:The evolution of expression divergence in wild C. elegans

| PRJNA1137531 | ENA

Duplication and expression evolution of butterfly mouthparts genes associated with feeding

Project description:Duplication and expression evolution of butterfly mouthparts genes associated with feeding

| PRJEB9022 | ENA