Ontology highlight
ABSTRACT:
PROVIDER: PRJNA531279 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR8865990_1.fastq.gz | Fastqsanger.gz | |||
| SRR8865990_2.fastq.gz | Fastqsanger.gz | |||
| SRR8866000_1.fastq.gz | Fastqsanger.gz | |||
| SRR8866000_2.fastq.gz | Fastqsanger.gz | |||
| SRR8866010_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 122 |
Similar Datasets
Project description:Primary outcome(s): Analysis of the diversity and composition of the gut microbiome by 16S rRNA sequencing
Study Design: Observational Study Model : Others, Time Perspective : Prospective, Enrollment : 60, Biospecimen Retention : Collect & Archive- Sample with DNA, Biospecimen Description : Blood, Stool
| 26030 | ecrin-mdr-crc
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
2023-11-07 | PXD037975 | JPOST Repository
Project description:Off-target amplification can lead to false positive human brain microbiome detection. 16s rRNA amplicon samples from brain tissue of healthy and Parkinson's disease patients.
| EGAD00001006553 | EGA
Project description:In this paper, we first report that EC smoking significantly increases the odds of gingival inflammation. Then, we seek to identify and explain the mechanism that underlies the relationship between EC smoking and gingival inflammation via the oral microbiome. We performed mediation analyses to assess if EC smoking affects the oral microbiome, which in turn affects gingival inflammation. For this, we collected saliva and subgingival samples from EC users and non-users and profiled their microbial compositions via 16S rRNA amplicon sequencing. We then performed α-diversity, β-diversity, and taxonomic differential analyses to survey the disparity in microbial composition between EC users and non-users. We found significant increases in α-diversity in EC users and disparities in β-diversity between EC users and non-users.
2022-12-09 | GSE201949 | GEO
Project description:The objectives of this study were to establish a microbiome profile for oral epithelial dysplasia using archival lesion swab samples to characterize the community variations and the functional potential of the microbiome using 16S rRNA gene sequencing
2022-09-30 | GSE198811 | GEO
Project description:The human gut is colonized by trillions of microorganisms that influence human health and disease through the metabolism of xenobiotics, including therapeutic drugs and antibiotics. The diversity and metabolic potential of the human gut microbiome have been extensively characterized, but it remains unclear which microorganisms are active and which perturbations can influence this activity. Here, we use flow cytometry, 16S rRNA gene sequencing, and metatranscriptomics to demonstrate that the human gut contains distinctive subsets of active and damaged microorganisms, primarily composed of Firmicutes, which display marked temporal variation. Short-term exposure to a panel of xenobiotics resulted in significant changes in the physiology and gene expression of this active microbiome. Xenobiotic-responsive genes were found across multiple bacterial phyla, encoding novel candidate proteins for antibiotic resistance, drug metabolism, and stress response. These results demonstrate the power of moving beyond DNA-based measurements of microbial communities to better understand their physiology and metabolism. RNA-Seq analysis of the human gut microbiome during exposure to antibiotics and therapeutic drugs.
2012-10-30 | E-GEOD-38151 | biostudies-arrayexpress
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
2017-05-12 | PXD006118 | Pride
Project description:A metaproteomics analysis was conducted on the infant fecal microbiome to characterize global protein expression in 8 samples obtained from infants with a range of early-life experiences. Samples included breast-, formula- or mixed-fed, mode of delivery, and antibiotic treatment and one set of monozygotic twins. Although label-free mass spectrometry-based proteomics is routinely used for the identification and quantification of thousands of proteins in complex samples, the metaproteomic analysis of the gut microbiome presents particular technical challenges. Among them: the extreme complexity and dynamic range of member taxa/species, the need for matched, well-annotated metagenomics databases, and the high inter-protein sequence redundancy/similarity between related members. In this study, a metaproteomic approach was developed for assessment of the biological phenotype and functioning, as a complement to 16S rRNA sequencing analysis to identify constituent taxa. A sample preparation method was developed for recovery and lysis of bacterial cells, followed by trypsin digestion, and pre-fractionation using Strong Cation Exchange chromatography. Samples were then subjected to high performance LC-MS/MS. Data was searched against the Human Microbiome Project database, and a homology-based meta-clustering strategy was used to combine peptides from multiple species into representative proteins. Bacterial taxonomies were also identified, based on species-specific protein sequences, and protein metaclusters were assigned to pathways and functional groups. The results obtained demonstrate the applicability of this approach for performing qualitative comparisons of human fecal microbiome composition, physiology and metabolism, and also provided a more detailed assessment of microbial composition in comparison to 16S rRNA.
2019-03-29 | PXD006033 | Pride
Project description:To investigate the TVA diet's effect on mouse gut microbiome, we fed C57/BL6 mice with TVA diet or CON diet for 18 days We then collected feces of the mice and performed 16S ribosomal RNA (rRNA) sequencing.
2023-09-21 | GSE202266 | GEO