Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Altered 3D chromatin structure permits inversional recombination at the IgH locus

ABSTRACT: Altered 3D chromatin structure permits inversional recombination at the IgH locus

PROVIDER: PRJNA550257 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR9586744.fastq.gz	Fastqsanger.gz
	SRR9586745.fastq.gz	Fastqsanger.gz
	SRR9586746.fastq.gz	Fastqsanger.gz
	SRR9586747.fastq.gz	Fastqsanger.gz
	SRR9586748.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 6

Similar Datasets

Altered 3D chromatin structure permits inversional recombination at the IgH locus

Project description:Altered 3D chromatin structure permits inversional recombination at the IgH locus

| PRJNA559943 | ENA

Altered 3D chromatin structure permits inversional recombination at the IgH locus (Capture Hi-C)

Project description:Altered 3D chromatin structure permits inversional recombination at the IgH locus (Capture Hi-C)

| PRJNA607280 | ENA

Altered 3D chromatin structure permits inversional recombination at the IgH locus

Project description:We report that in the absence of intergenic control region 1 (IGCR1), a regulatory sequence that specifies the RAG scanning domain on WT IgH alleles, VH and DH gene segments can recombine with each other by both deletion and inversion of intervening DNA.

2020-06-18 | GSE133185 | GEO

Altered 3D chromatin structure permits inversional recombination at the IgH locus

2020-07-02 | GSE135763 | GEO

Altered 3D chromatin structure permits inversional recombination at the IgH locus (Capture Hi-C)

Project description:We reoprt that in the absence of intergenic control region 1 (IGCR1), a regulatory sequence that specifies the RAG scanning domain on WT IgH alleles, VH and DH gene segments can recombine with each other by both deletion and inversion of intervening DNA.

2020-07-01 | GSE145472 | GEO

Altered 3D chromatin structure permits inversional recombination at the IgH locus.

Project description:Immunoglobulin heavy chain (IgH) genes are assembled by two sequential DNA rearrangement events that are initiated by recombination activating gene products (RAG) 1 and 2. Diversity (DH) gene segments rearrange first, followed by variable (VH) gene rearrangements. Here, we provide evidence that each rearrangement step is guided by different rules of engagement between rearranging gene segments. DH gene segments, which recombine by deletion of intervening DNA, must be located within a RAG1/2 scanning domain for efficient recombination. In the absence of intergenic control region 1, a regulatory sequence that delineates the RAG scanning domain on wild-type IgH alleles, VH and DH gene segments can recombine with each other by both deletion and inversion of intervening DNA. We propose that VH gene segments find their targets by distinct mechanisms from those that apply to DH gene segments. These distinctions may underlie differential allelic choice associated with each step of IgH gene assembly.

| S-EPMC7428332 | biostudies-literature

Enhancers of the PAIR4 regulatory module promote distal VH gene recombination at the Igh locus

Project description:While extended loop extrusion across the entire Igh locus controls VH-DJH recombination, local regulatory sequences, such as the PAIR elements, may also activate VH gene recombination in pro-B-cells. Here we show that PAIR-associated VH8 genes contain a conserved putative regulatory element (V8E) in their downstream sequences. To investigate the function of PAIR4 and its V8.7E, we deleted all 14 PAIRs in the Igh 5’-region, which reduced distal VH gene recombination over a 100-kb distance on either side of the 890-kb deletion. Reconstitution by insertion of PAIR4-V8.7E strongly activated distal VH gene recombination. PAIR4 alone resulted in lower induction of recombination, indicating that PAIR4 and V8.7E function as one regulatory unit. The pro-B-cell-specific activity of PAIR4 depends on CTCF, as mutation of its CTCF-binding site led to sustained PAIR4 activity in pre-B and immature B-cells and in PAIR4 activation in T-cells. Notably, insertion of V8.8E was sufficient to activate VH gene recombination. Hence, enhancers of the PAIR4-V8.7E module and V8.8E element activate distal VH gene recombination and thus contribute to the diversification of the BCR repertoire in addition to loop extrusion.

2023-05-01 | GSE214869 | GEO

Large-scale nucleosome density patterns and precise nucleosome positioning correlate with V(D)J recombination at the IgH locus in a cell-type specific manner

Project description:In this study, we compare the chromatin structure of the Ig heavy (IgH) chain locus (performing MNase digestion) in three murine cell types rendered recombinationally inactive by loss of a RAG recombinase: (i) RAG2-/- Pro-B cell lines, where the entire IgH locus is poised and available for recombination, (ii) RAG1-/- Pro-T cell lines, lymphoid cells where the IgH locus is partly open but the V region does not rearrange, (iii) recombinationally inactive RAG2-/- mouse embryonic fibroblasts (MEFs), where the entire IgH locus is in a closed conformation and unavailable for rearrangement. Our findings suggest that developmentally-regulated changes in nucleosome location and occupancy play a fundamental role in regulating V(D)J recombination, by creating and controlling the accessibility of recombination signal sequences.

2016-01-31 | GSE75018 | GEO

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.

2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress

Wapl repression by Pax5 promotes loop extrusion and V gene recombination at the Igh locus

Project description:The generation of a diverse antibody repertoire is essential for humoral immunity and requires the participation of all V genes in V(D)J recombination, which depends on the Pax5-regulated contraction of the 2.8-Mb long immunoglobulin heavy-chain (Igh) locus. How Pax5 controls Igh contraction in pro-B cells is, however, not known. Here, we demonstrate that locus contraction is caused by cohesin-mediated chromatin loop extrusion across the entire Igh locus. Notably, expression of the cohesin-release factor Wapl is repressed by Pax5 specifically in pro-B and pre-B cells, which facilitates extended loop extrusion by increasing the residence time of cohesin on chromatin. Pax5 mediates the transcriptional repression of Wapl through a single Pax5-binding site by recruiting the Polycomb repressive complex 2 to induce bivalent chromatin at the Wapl promoter. Reduced Wapl expression causes global alterations of the three-dimensional chromatin architecture, indicating that the potential to recombine all V genes entails structural changes of the entire genome in pro-B cells.

2020-07-01 | GSE140975 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data