Ontology highlight
ABSTRACT:
PROVIDER: PRJNA553795 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR9686200_1.fastq.gz | Fastqsanger.gz | |||
| SRR9686200_2.fastq.gz | Fastqsanger.gz | |||
| SRR9686210_1.fastq.gz | Fastqsanger.gz | |||
| SRR9686210_2.fastq.gz | Fastqsanger.gz | |||
| SRR9686220_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 140 |
Similar Datasets
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:16S rRNA amplicon sequencing from wastewater treatment and reclamation systems
| PRJDB13798 | ENA
Project description:Understanding microbial community diversity is thought to be crucial for improving process functioning and stabilities of wastewater treatment systems. However, current studies largely focus on taxonomic groups based on 16S rRNA, which are not necessarily linked to functioning, or a few selected functional genes. Here we launched a study to profile the overall functional genes of microbial communities in three full-scale wastewater treatment systems. Triplicate activated sludge samples from each system were analyzed using a high-throughput metagenomics tool named GeoChip 4.2, resulting in the detection of 38,507 to 40,647 functional genes. A high similarity of 75.5% to 79.7% shared genes was noted among the nine samples. Moreover, correlation analyses showed that the abundances of a wide array of functional genes were associated with system performances. For example, the abundances of overall nitrogen cycling genes had a strong correlation to total nitrogen (TN) removal rates (r = 0.7647, P < 0.01). The abundances of overall carbon cycling genes were moderately correlated with COD removal rates (r = 0.6515, P < 0.01). Lastly, we found that influent chemical oxygen demand (COD inf) and total phosphorus concentrations (TP inf), and dissolved oxygen (DO) concentrations were key environmental factors shaping the overall functional genes. Together, the results revealed vast functional gene diversity and some links between the functional gene compositions and microbe-mediated processes.
2014-12-31 | GSE53744 | GEO
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
2017-05-12 | PXD006118 | Pride