Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: High-throughput sequencing of bacterial 16S RNA

PROVIDER: PRJNA567920 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR10154312_1.fastq.gz	Fastqsanger.gz
	SRR10154312_2.fastq.gz	Fastqsanger.gz
	SRR10154313_1.fastq.gz	Fastqsanger.gz
	SRR10154313_2.fastq.gz	Fastqsanger.gz
	SRR10154314_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 16

Similar Datasets

Gut microbiota dysbiosis and neurological function recovery after intracerebral hemorrhage [16S rRNA-Seq]

Project description:We aimed to investigate the microbial community composition in patients with intracerebral hemorrhage (ICH) and its effect on prognosis. The relationship between changes in bacterial flora and the prognosis of spontaneous cerebral hemorrhage was studied in two cohort studies. Fecal samples from healthy volunteers and patients with intracerebral hemorrhage were subjected to 16S rRNA sequencing at three time points: T1 (within 24 hours of admission), T2 (3 days post-surgery), and T3 (7 days post-surgery) using Illumina high-throughput sequencing technology.

2024-08-22 | E-MTAB-14351 | biostudies-arrayexpress

Project description:16S High-throughput sequencing

| PRJNA984178 | ENA

Project description:16S high throughput sequencing

| PRJNA820991 | ENA

To explore the relationship between new gene expression / mutation and survival of patients in colorectal cancer

Project description:Interventions: Case vs control:No Primary outcome(s): High-throughput sequencing Study Design: Case-Control study

| 2676067 | ecrin-mdr-crc

16S rDNA sequencing of BALB/c and C57BL/7 mouse gut microbiomes

Project description:Age-dependent changes of the gut-associated microbiome have been linked to increased frailty and systemic inflammation. This study found that age-associated changes of the gut microbiome of BALB/c and C57BL/6 mice could be reverted by co-housing of aged (22 months old) and adult (3 months old) mice for 30-40 days or faecal microbiota transplantation (FMT) from adult into aged mice. This was demonstrated using high-throughput sequencing of the V3-V4 hypervariable region of bacterial 16S rRNA gene isolated from faecal pellets collected from 3-4 months old adult and 22-23 months old aged mice before and after co-housing or FMT.

2019-05-08 | E-MTAB-7750 | biostudies-arrayexpress

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Project description:16s rRNA high-throughput sequencing

| PRJNA794205 | ENA

Project description:16S rRNA High-Throughput Sequencing

| PRJNA464196 | ENA

Project description:Soil 16S high-throughput sequencing

| PRJNA967487 | ENA

Project description:High-throughput sequencing of 16S

| PRJNA821324 | ENA