Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Seawater

ABSTRACT: Seawater 16S amplicon sequencing

PROVIDER: PRJNA577349 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR10273076_1.fastq.gz	Fastqsanger.gz
	SRR10273076_2.fastq.gz	Fastqsanger.gz
	SRR10273077_1.fastq.gz	Fastqsanger.gz
	SRR10273077_2.fastq.gz	Fastqsanger.gz
	SRR10273078_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 16

Similar Datasets

seawater metagenome

Project description:16S rRNA amplicon sequencing of eDNA collected from seawater near Sesoko Island, Okinawa

| PRJDB11347 | ENA

Seawater samples

Project description:16S Amplicon Metagenomic Sequencing

| PRJNA823745 | ENA

16s RNA sequencing data from environmental and steel corrosion samples, Shoreham Harbour, UK

Project description:16s RNA gene sequencing data from seawater, bed sediment and steel corrosion samples from Shoreham Harbour, UK, collected to allow bacterial species comparisons between microbially influenced corrosion, the surrounding seawater, and the sea bed sediment at the seafloor and 50cm depth below seafloor.

2019-10-06 | E-MTAB-8373 | biostudies-arrayexpress

Experimental tests strongly challenge the evidence of a healthy human blood microbiome

Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.

2024-03-01 | GSE254843 | GEO

Soil Metaproteomics LC-MS

Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.

2022-03-01 | PXD009773 | Pride

Transcriptional response to seawater acidification and hyperthermal stress in the azooxanthellate octocoral, Scleronephthya gracillimum

Project description:The soft coral Scleronephthya gracillimum is an azooxanthellate octocoral order Alcyonacea. In this study, stress responses to increased seawater temperature and marine acidification were investigated using a microarray. The S. gracillimum microarray was constructed. The S. gracillimum microarray was constructed after RNA-seq. Oligonucleotides were picked from UniGene of S. gracillimum and the clones were annotated using Blast.

2021-07-24 | GSE180633 | GEO

seawater

Project description:seawater genome sequencing

| PRJNA982396 | ENA

Quantification of mock microbial communities with metagenomes, 16S rRNA gene amplicons and metaproteomics

Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.

2017-05-12 | PXD006118 | Pride

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

seawater metagenome

Project description:Amplicon sequencing of 18S rRNA gene, eukaryote assemblages in seawater in Matsushima Bay, Japan

| PRJDB13931 | ENA