Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S amplicon sequencing of sputa from tuberculosis patients

PROVIDER: PRJNA611472 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR11280300_1.fastq.gz	Fastqsanger.gz
	SRR11280300_2.fastq.gz	Fastqsanger.gz
	SRR11280400_1.fastq.gz	Fastqsanger.gz
	SRR11280400_2.fastq.gz	Fastqsanger.gz
	SRR11280301_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 547

Similar Datasets

Differential Expression of Long Non-Coding RNAs in Patients with Tuberculosis Infection

Project description:The differential expression of the long non-coding RNAs (lncRNAs) in the sputa from patients with Tuberculosis (TB) as (TB positive), community acquired pneumonia (CAP) and healthy individuals (CG) using lncRNA microarray scanning were evaluated. It was found that there were 2116 specific lncRNAs differentially expressed in the TB positive samples (1102 up-regulated and 1014 down-regulated), which accounted for 6.96% of total lncRNAs.

2017-07-25 | GSE101805 | GEO

Experimental tests strongly challenge the evidence of a healthy human blood microbiome

Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.

2024-03-01 | GSE254843 | GEO

Project description:16S data from sputa from cystic fibrosis patients

| PRJNA1091406 | ENA

Soil Metaproteomics LC-MS

Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.

2022-03-01 | PXD009773 | Pride

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Quantification of mock microbial communities with metagenomes, 16S rRNA gene amplicons and metaproteomics

Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.

2017-05-12 | PXD006118 | Pride

In vivo M. tuberculosis transcriptome in the lung

Project description:We compared the transcriptional signature of 7 human sputa to exponential and stationary phase culture and identified transcriptional signature to sputa

2022-01-12 | GSE137518 | GEO

Microbial communities in the gut of the beetle Odontotaenius disjunctus

Project description:16S amplicon pool analyses of the four gut sections of the wood-feeding beetle, Odontotaenius disjunctus The beetle is purely wood feeding, and we aim to first characterize the community that exist within the gut sections

2012-08-14 | GSE40067 | GEO

Human gut microbiota, COVID-19 patients with mild or severe symptoms.

Project description:Analysis of COVID-19 hospitalized patients, with different kind of symptoms, by human rectal swabs collection and 16S sequencing approach.

2022-09-22 | E-MTAB-12236 | biostudies-arrayexpress

human metagenome

Project description:16s analysis on sputa and feces

| PRJNA310395 | ENA