Project description:v3-v4 16S rRNA sequencing was used to characterize both gut and oral microbiota composition of RCC (refractory chronic cough) patients and matched healthy controls (HC). The groups are matched in age and gender.
Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.
Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.
Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.
Project description:Total DNA was extracted from FFPE specimens of breast tumor and surrounding healthy tissue, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.
Project description:Total DNA was extracted from the stool of the patients, amplified to collect amplicons of variable V3–V4 regions (primers 341F and 805R) of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.
Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach. Phylogenetic study of the Treponema taxa found in digital dermatitis lesions of Holstein cows.
Project description:Understanding the environmental factors that shape microbial communities is crucial, especially in extreme environments, like Antarctica. Two main forces were reported to influence Antarctic soil microbes: birds and plants. Both birds and plants are currently undergoing unprecedented changes in their distribution and abundance due to global warming. However, we need to clearly understand the relationship between plants, birds and soil microorganisms. We therefore collected rhizosphere and bulk soils from six different sampling sites subjected to different levels of bird influence and colonized by Colobanthus quitensis and Deschampsia antarctica in the Admiralty Bay, King George Island, Maritime Antarctic. Microarray and qPCR assays targeting 16S rRNA genes of specific taxa were used to assess microbial community structure, composition and abundance and analyzed with a range of soil physico-chemical parameters. The results indicated significant rhizosphere effects in four out of the six sites, including areas with different levels of bird influence. Acidobacteria were significantly more abundant in soils with little bird influence (low nitrogen) and in bulk soil. In contrast, Actinobacteria were significantly more abundant in the rhizosphere of both plant species. At two of the sampling sites under strong bird influence (penguin colonies), Firmicutes were significantly more abundant in D. antarctica rhizosphere but not in C. quitensis rhizosphere. The Firmicutes were also positively and significantly correlated to the nitrogen concentrations in the soil. We conclude that the microbial communities in Antarctic soils are driven both by bird and plants, and that the effect is taxa-specific.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:V3-V4 16S rRNA Amplicon based Sequencing.
