Synthetic RNA
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA669024 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR12931449.fastq.gz | Fastqsanger.gz | |||
| SRR12931450.fastq.gz | Fastqsanger.gz | |||
| SRR12931451.fastq.gz | Fastqsanger.gz | |||
| SRR12931452.fastq.gz | Fastqsanger.gz | |||
| SRR12931453.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 44 |
Similar Datasets
Project description:Cas12a CRISPR technology, unlike Cas9, allows for multiplexing guide RNAs from a single transcript, simplifying combinatorial perturbations. While Cas12a has been implemented for multiplexed knockout genetic screens, it has yet to be optimized for CRISPR activation (CRISPRa) screens in human cells. Here we develop a new Cas12a-based transactivation domain (TAD) recruitment system using the ALFA nanobody and demonstrate simultaneous activation of up to four genes. We screen a genome-wide library to identify modulators of growth and MEK inhibition, and we compare these results to those obtained with open reading frame (ORF) overexpression and Cas9-based CRISPRa. We find that the activity of multiplexed arrays is largely predictable from the best-performing guide and we provide criteria for selecting active guides. We anticipate that these results will greatly accelerate the exploration of gene function and combinatorial phenotypes at scale.
2023-05-09 | GSE231789 | GEO
Project description:Cas12a CRISPR technology, unlike Cas9, allows for multiplexing guide RNAs from a single transcript, simplifying combinatorial perturbations. While Cas12a has been implemented for multiplexed knockout genetic screens, it has yet to be optimized for CRISPR activation (CRISPRa) screens in human cells. Here we develop a new Cas12a-based transactivation domain (TAD) recruitment system using the ALFA nanobody and demonstrate simultaneous activation of up to four genes. We screen a genome-wide library to identify modulators of growth and MEK inhibition, and we compare these results to those obtained with open reading frame (ORF) overexpression and Cas9-based CRISPRa. We find that the activity of multiplexed arrays is largely predictable from the best-performing guide and we provide criteria for selecting active guides. We anticipate that these results will greatly accelerate the exploration of gene function and combinatorial phenotypes at scale.
2023-05-08 | GSE230445 | GEO
Project description:Compact and versatile CRISPR-Cas systems will enable genome engineering applications through high-efficiency delivery in a wide variety of contexts. Here we create an efficient miniature Cas system (CasMINI) engineered from the type V-F Cas12f (Cas14) system by guide RNA and protein engineering, which is less than half the size of currently used CRISPR systems (Cas9 or Cas12a). We demonstrate that CasMINI can drive high levels of gene activation (up to thousands-fold increases), while the natural Cas12f system fails to function in mammalian cells. We show that the CasMINI system has comparable activities to Cas12a for gene activation, is highly specific, and allows for robust base editing and gene editing. We expect that CasMINI can be broadly useful for cell engineering and gene therapy applications ex vivo and in vivo.
2021-09-10 | GSE180773 | GEO
Project description:Systematic mapping of genetic interactions and interrogation of the functions of sizeable genomic segments in mammalian cells represent important goals of biomedical research. To advance these goals, we present a CRISPR-based screening system for combinatorial genetic manipulation that employs co-expression of Cas9 and Cas12a nucleases and machine learning-optimized libraries of hybrid Cas9-Cas12a guide RNAs. This system, named CHyMErA (Cas Hybrid for Multiplexed Editing and Screening Applications), outperforms genetic screens using Cas9 or Cas12a editing alone. Application of CHyMErA to the ablation of mammalian paralog gene pairs reveals extensive genetic interactions and uncovers phenotypes normally masked by functional redundancy. Application of CHyMErA in a chemo-genetic interaction screen identifies genes that impact cell growth in response to mTOR pathway inhibition. Moreover, by systematically targeting thousands of alternative splicing events, CHyMErA identifies exons underlying human cell line fitness. CHyMErA thus represents an effective screening approach for genetic interaction mapping and the functional analysis of sizeable genomic regions, such as alternative exons.
2020-02-29 | GSE144078 | GEO
Project description:Systematic mapping of genetic interactions and interrogation of the functions of sizeable genomic segments in mammalian cells represent important goals of biomedical research. To advance these goals, we present a CRISPR-based screening system for combinatorial genetic manipulation that employs co-expression of Cas9 and Cas12a nucleases and machine learning-optimized libraries of hybrid Cas9-Cas12a guide RNAs. This system, named CHyMErA (Cas Hybrid for Multiplexed Editing and Screening Applications), outperforms genetic screens using Cas9 or Cas12a editing alone. Application of CHyMErA to the ablation of mammalian paralog gene pairs reveals extensive genetic interactions and uncovers phenotypes normally masked by functional redundancy. Application of CHyMErA in a chemo-genetic interaction screen identifies genes that impact cell growth in response to mTOR pathway inhibition. Moreover, by systematically targeting thousands of alternative splicing events, CHyMErA identifies exons underlying human cell line fitness. CHyMErA thus represents an effective screening approach for genetic interaction mapping and the functional analysis of sizeable genomic regions, such as alternative exons.
2020-01-28 | GSE144281 | GEO
Project description:Synthetic transcription factors can be applied in many areas of biotechnology, medicine, and basic research. In contrast to current methods based on engineering new DNA-binding proteins, we show that Cas9 fused to a transcriptional activation domain can be targeted by combinations of guide RNA molecules to induce the expression of endogenous human genes. This simple approach for targeted gene activation circumvents the need for engineering new proteins and will enable widespread synthetic gene regulation. HEK293T cells were transfected with plasmid expressing Cas9-VP64 fusion protein and a guide RNA. As a control, empty guide RNA was transfected. Gene expression was then measured using mRNA-seq, and differential expression calculated using DESeq. All experiments were performed in biological duplicates or triplicates.
2013-07-25 | E-GEOD-47114 | biostudies-arrayexpress
Project description:Because of their smallness, the recently developed CRISPR-Cas12f nucleases can be effectively packaged into adeno-associated viruses for gene therapy. However, a systematic evaluation of the editing outcomes of CRISPR-Cas12f is lacking. In this study, we apply a high-throughput sequencing method to comprehensively assess the editing efficiency, specificity, and safety of four Cas12f proteins in parallel with that of Cas9 and two Cas12a proteins at multiple genomic sites. Cas12f nucleases achieve robust cleavage at most of the tested sites and mainly produce deletional fragments. In contrast, Cas9 and Cas12a show relatively higher editing efficiency at the vast majority of the tested sites. However, the off-target hotspots identified in the Cas9- and Cas12a-edited cells are negligibly detected in the Cas12f-edited cells. Moreover, compared to Cas9 and Cas12a nucleases, Cas12f nucleases reduce the levels of chromosomal translocations, large deletions, and integrated vectors by 2- to 3-fold. Therefore, our findings confirm the editing capacity of Cas12f and reveal the ability of this nuclease family to preserve genome integrity during genome editing.
2022-09-12 | GSE213149 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Therapeutic targeting of the adenosine deaminase ADAR has great potential in cancer and other indications; however, it remains unclear what approach can enable effective and selective therapeutic inhibition. Herein, we conduct multi-staged guide RNA screening and identify high efficiency Cas9 guide RNAs to enable a CRISPR/Cas-based approach for ADAR knockout. Through characterization in human primary immune cell systems we observe similar activity with two-part guide RNA and single guide RNA, dose responsive activity, similar guide activity rank order across different cell types, and favorable computational off-target profiles of candidate guide RNAs. We determine that knockout of ADAR using these guide RNAs induces pharmacodynamic responses primarily consisting of immunological responses such as a type I interferon response, consistent with the known function of ADAR as a key regulator of dsRNA sensing. We observe similar biological effects with targeting only the p150 isoform or both p110 and p150 isoforms of ADAR, indicating that at least in the contexts evaluated, loss of p150 ADAR mediates the primary response. These findings provide a resource of well-characterized, high efficiency ADAR-targeting Cas9 guide RNAs suitable for genomic medicines utilizing different delivery modalities and addressing different therapeutic areas.
2025-01-08 | GSE280530 | GEO
Project description:The RNA-induced silencing complex, comprising Argonaute and guide RNA, mediates RNA interference. Here we report the 3.2 M-CM-^E crystal structure of Kluyveromyces Argonaute (KpAGO) fortuitously complexed with guide RNA originating from small-RNA duplexes autonomously loaded by recombinant KpAGO. Despite their diverse sequences, guide-RNA nucleotides 1-8 are positioned similarly, with sequence-independent contacts to bases, phosphates and 2'-hydroxyl groups pre-organizing the backbone of nucleotides 2-8 in a near-A-form conformation. Compared with prokaryotic Argonautes, KpAGO has numerous surface-exposed insertion segments, with a cluster of conserved insertions repositioning the N domain to enable full propagation of guide-target pairing. Compared with Argonautes in inactive conformations, KpAGO has a hydrogen-bond network that stabilizes an expanded and repositioned loop, which inserts an invariant glutamate into the catalytic pocket. Mutation results and analogies to Ribonuclease H indicate that insertion of this glutamate finger completes a universally conserved catalytic tetrad, thereby activating Argonaute for cleavage. High-throughput sequencing of cellular RNAs containing both a 5'-monophosphate group and a poly(A) tail. To identify Argonaute-dependent cleavage tags, sequencing libraries were prepared from M-NM-^Txrn1 and M-NM-^Txrn1 M-NM-^Tago1 strains.
2012-05-14 | E-GEOD-37723 | biostudies-arrayexpress