Ontology highlight
ABSTRACT:
PROVIDER: PRJNA669108 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR12835500_1.fastq.gz | Fastqsanger.gz | |||
| SRR12835500_2.fastq.gz | Fastqsanger.gz | |||
| SRR12835501_1.fastq.gz | Fastqsanger.gz | |||
| SRR12835501_2.fastq.gz | Fastqsanger.gz | |||
| SRR12835502_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 216 |
Similar Datasets
Project description:Iron-rich pelagic aggregates (iron snow) were collected directly onto silicate glass filters using an electronic water pump installed below the redoxcline. RNA was extracted and library preparation was done using the NEBNext Ultra II directional RNA library prep kit for Illumina. Data was demultiplied by GATC sequencing company and adaptor was trimmed by Trimgalore. After trimming, data was processed quality control by sickle and mRNA/rRNA sequences were sorted by SortmeRNA. mRNA sequences were blast against NCBI-non redundant protein database and the outputs were meganized in MEGAN to do functional analysis. rRNA sequences were further sorted against bacterial/archeal 16S rRNA, eukaryotic 18S rRNA and 10,000 rRNA sequences of bacterial 16S rRNA, eukaryotic 18S rRNA were subset to do taxonomy analysis.
2021-10-15 | E-MTAB-9686 | biostudies-arrayexpress
Project description:To determine microbiota composition associated with loss of KDM5 in intestine, we carried out 16S rRNA seq analyses of dissected intestine from wildtype and kdm5 mutant. [GSM2628181-GSM2628190]. A total of 78 operational taxonomic units (OTUs) were identified in the sequence data. There were about 15 genera much less abundant in kdm5 mutant compared to wildtype. The kdm5 mutant were sensitive to pathogen. To confirm the microbiota associated with loss of KDM5 in intestine, 16S rRNA of new flies were sequenced and analyzed by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China) [GSM3243472-GSM3243481]. A total of 107 operational taxonomic units (OTUs) were identified in the sequence data. There were about 20 genera much less abundant in kdm5 mutant compared to wildtype. To confirm the microbiota associated with loss of KDM5 drosophila feeding with Lactobacillus plantarum, 16S rRNA of kdm5 mutant flies were sequenced and analyzed by Novogene Bioinformatics Technology Co., Ltd. (Tianjin, China) [GSM3263522-GSM3263527]. A total of 92 operational taxonomic units (OTUs) were identified in the sequence data. To confirm the microbiota associated with KDM5 knockdown in intestine, 16S rRNA of Myo1A-Gal4TS/+ and Myo1A-Gal4TS/+;+/kdm5RNAi flies were sequenced and analyzed by Biomarker Co. Ltd. (Beijing, China). [GSM3507915-GSM3507924]. A total of 50 operational taxonomic units (OTUs) were identified in the sequence data. There was a significant different based on the genus level between two groups.
2019-02-08 | GSE98944 | GEO
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
2023-11-07 | PXD037975 | JPOST Repository
Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles.
2016-01-01 | GSE73842 | GEO
Project description:Ribosomes of Bacteroidia (formerly Bacteroidetes) fail to recognize Shine-Dalgarno (SD) sequences even though they harbor the anti-SD (ASD) of 16S rRNA. This is due to sequestration of the 3’ tail of 16S rRNA in a pocket formed by bS21, bS18, and bS6 on the 30S platform, which functionally occludes the ASD. Interestingly, in many Flavobacteriales, the gene encoding bS21, rpsU, contains an extended SD sequence. In this work, we present genetic and biochemical evidence that bS21 synthesis in Flavobacterium johnsoniae is autoregulated via a subpopulation of ribosomes that specifically lack bS21. Mutation or depletion of bS21 in the cell specifically increases translation of reporters with strong SD sequences, such as rpsU’-gfp. Purified ribosomes lacking bS21 (or its C-terminal region) exhibit higher rates of initiation on rpsU mRNA and lower rates of initiation on other (SD-less) mRNAs than control ribosomes. The mechanism of autoregulation depends on extensive pairing between mRNA and 16S rRNA, and exceptionally strong SD sequences, with predicted pairing free energies of < –13 kcal/mol, are characteristic of rpsU across the Bacteroidia. To our knowledge, this is the first example of biochemically-verified specialized ribosomes with a clear regulatory purpose.
2023-03-11 | PXD036353 | Pride
Project description:Mitochondrial rRNAs play important roles in regulating mtDNA-encoded gene expression and energy metabolism subsequently. However, the proteins that regulate mitochondrial 16S rRNA processing remain poorly understood. Herein, we generated adipose-specific Wbscr16-/- mice and cells, both of which exhibited dramatic mitochondrial changes. Subsequently, WBSCR16 was identified as a 16S rRNA-binding protein essential for the cleavage of 16S rRNA-mt-tRNALeu, facilitating 16S rRNA processing and mitochondrial ribosome assembly. Additionally, WBSCR16 recruited RNase P subunit MRPP3 to nascent 16S rRNA and assisted in this specific cleavage. Furthermore, evidence showed that adipose-specific Wbscr16 ablation promotes energy wasting via lipid preference in brown adipose tissue, leading to excess energy expenditure and resistance to obesity. In contrast, overexpression of WBSCR16 upregulated 16S rRNA processing and induced a preference for glucose utilization in both transgenic mouse models and cultured cells. These findings suggest that WBSCR16 plays essential roles in mitochondrial 16S rRNA processing in mammals, and is the key mitochondrial protein to balance glucose and lipid metabolism.
2024-12-30 | GSE229693 | GEO
Project description:An Easy Operating Pathogen Microarray (EOPM) was designed to detect almost all known pathogens and related species based on their genomic sequences. For effective identification of pathogens from EOPM data, a statistical enrichment algorithm has been proposed and further implemented in a user-friendly interface. A microarray was designed with probes for vertebrate-infecting virus sequences in EMBL, 18S rRNA fungi and parasite sequences from EMBL, and 16S rRNA sequences of bacteria from RDP, synthesized on the Agilent platform. The array was tested using 2 color dyes on cultured microbes and on clinical samples from sick and healthy people, looking for differences in clinically ill people compared to a number of healthy "controls".
2013-07-01 | E-GEOD-45860 | biostudies-arrayexpress
Project description:This study aimed to model formamide-based melting for the optimization of the sensitivity and specifcity of oligonucleotide probes in dignostic high-density microarrays. Formamide melting profiles of DNA oligonucleotides were obtained with a high-density microarray targeting 16S rRNA genes of Escherichia coli and Rhodobacter sphaeroides. One or two mismatched versions of perfect match probes were included on the array to systematically analyze the effect of formamide on mismatch stability and mismatch discrimination. A thermodynamics-based mathematical model of formamide denaturation was developed to predict the formamide melting profiles with sufficient accuracy to help with oligonucleotide design in microbial ecology applications. 16S rRNA sequences with GenBank accession codes U00006 ( E. coli ) and X53853 (R. sphaeroides) were used for probe design. The following oligonucleotide probe sets were used for the systematic analysis of the effect of formamide on probe-target hybrids (parenthetic information gives set name followed by the number of probes): 22-mer perfect match probes tiling the 16S rRNA gene of E. coli (TileE, n=1521), perfect match E.coli probes of variable length between 18 and 26 mers (Length, n=1045), E. coli probes with central single mismatches (OneM, n=1563), E. coli probes with single positional mismatches (PosM, n=4092), E. coli probes with single deletion mismatches (Gap, n=248), E. coli probes with single insertion mismatches (Insertion, n=248), E. coli probes with two separate mismatches (TwoM, n=1674), E. coli probes with central tandem mismatches (Tandem, n=558), and 22-mer perfect match probes tiling the 16S rRNA gene of R. sphaeroides. Also, a probe with no match to 16S rRNA genes was used as a background control. On the array, regular probes were replicated three times and the Nonsense probe ten times. See the manuscript of Yilmaz et al. for details.
2012-06-29 | E-GEOD-33021 | biostudies-arrayexpress
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO