Ontology highlight
ABSTRACT:
PROVIDER: PRJNA673162 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR12961100_1.fastq.gz | Fastqsanger.gz | |||
| SRR12961100_2.fastq.gz | Fastqsanger.gz | |||
| SRR12961101_1.fastq.gz | Fastqsanger.gz | |||
| SRR12961101_2.fastq.gz | Fastqsanger.gz | |||
| SRR12961102_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 68 |
Similar Datasets
Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles.
2016-01-01 | GSE73842 | GEO
Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles. A total of 56 samples were collected that represent water and sediment samples from 14 sample sites over two different time points (November 18 and 25, 2011).
2016-07-03 | E-GEOD-73842 | biostudies-arrayexpress
Project description:We have developed a 60-mer oligonucleotide multibacterial microarray for detection and expression profiling of biodegradative genes and bacterial diversity (16S rRNA gene) in different habitats contaminated with varieties of hazardous chemicals. The genes selected were involved in biodegradation and biotransformation of various groups of compounds viz. nitroaromatic compounds (148 genes), chloroaromatic compounds (75 genes), monoaromatic compounds (373 genes), polyaromatic hydrocarbons (174 genes), pesticides/ herbicides (34 genes), alkanes/aliphatics (185 genes) and heavy metals (68 genes), which covered a total number of 133 chemicals. The efficiency (specificity, detection sensitivity) of the developed array was evaluated using the labeled genomic DNA of pure bacterial strains, Escherichia coli DH5α and Sphingomonas sp. strain NM-05 (involved in the biodegradation of γ-hexachlorohexane isolated from IPL, Lucknow) at different concentrations of 300ng, 500ng, 800ng, 1000ng and 1250ng. The specificity of the developed array was further validated using mixed cultures containing three strains (Sphingomonas sp. strain NM-05, Rhodococcus sp. strain RHA1 and Bordetella sp. strain IITR-02) involved in biodegradation of γ-hexachlorohexane, biphenyl and chlorobenzenes respectively. The mixed culture also contained non-target/non-degrader strains (E. coli DHα, E.coli BL21 and E.coli K12 NCTC50192). The developed array was applied for profiling using the total soil DNA in five contaminated habitats of north India, viz. chloroaromatic chemicals contaminated site (India Pesticide Limited, Chinhat, Lucknow), a river sediments (Gomti river sediment, Lucknow), heavy metal industry dump site (Jajmau industrial area Kanpur), a effluent treatment plant (CETP along Ganges river near Kanpur), and an oil refinery (Mathura oil refinery). Hybridization of 16S rRNA probes revealed the presence of bacteria similar to well characterized genera involved in biodegradation of pollutants. Genes involved in complete degradation pathways for hexachlorocyclohexane (lin), 1,2,4-trichlorobenzene (tcb), naphthalene (nah), phenol (mph), biphenyl (bph), benzene (ben), toluene (tbm), xylene (xyl), phthalate (pht), Salicylate (sal) and resistance to mercury (mer) were detected with highest intensity. The most abundant genes belonged to hydroxylases, monooxygenases and dehydrogenases which were present in all the five samples. Many compound specific genes which initiate the degradation pathway were also detected. Thus, the array developed and validated here may be useful in assessing the biodegradative potential and composition of environmentally useful bacteria in hazardous ecosystems.
2011-04-15 | GSE24353 | GEO
Project description:To explore how gene expression translates to developmental phenotype in both sensitive and resistant Fundulus embryos upon POP exposure, we exposed Fundulus embryos from the Elizabeth River Superfund population and the Magotha Bay, VA clean population to Elizabeth River polluted sediment extracts and measured chemical uptake, gene expression, and altered embryo anatomy, morphology and cardiac physiology during four critical developmental stages: somitogenesis, heart beat initiation, late organogenesis, and pre-hatching.
2019-05-07 | GSE130754 | GEO
Project description:We have developed a 60-mer oligonucleotide multibacterial microarray for detection and expression profiling of biodegradative genes and bacterial diversity (16S rRNA gene) in different habitats contaminated with varieties of hazardous chemicals. The genes selected were involved in biodegradation and biotransformation of various groups of compounds viz. nitroaromatic compounds (148 genes), chloroaromatic compounds (75 genes), monoaromatic compounds (373 genes), polyaromatic hydrocarbons (174 genes), pesticides/ herbicides (34 genes), alkanes/aliphatics (185 genes) and heavy metals (68 genes), which covered a total number of 133 chemicals. The efficiency (specificity, detection sensitivity) of the developed array was evaluated using the labeled genomic DNA of pure bacterial strains, Escherichia coli DH5M-NM-1 and Sphingomonas sp. strain NM-05 (involved in the biodegradation of M-NM-3-hexachlorohexane isolated from IPL, Lucknow) at different concentrations of 300ng, 500ng, 800ng, 1000ng and 1250ng. The specificity of the developed array was further validated using mixed cultures containing three strains (Sphingomonas sp. strain NM-05, Rhodococcus sp. strain RHA1 and Bordetella sp. strain IITR-02) involved in biodegradation of M-NM-3-hexachlorohexane, biphenyl and chlorobenzenes respectively. The mixed culture also contained non-target/non-degrader strains (E. coli DHM-NM-1, E.coli BL21 and E.coli K12 NCTC50192). The developed array was applied for profiling using the total soil DNA in five contaminated habitats of north India, viz. chloroaromatic chemicals contaminated site (India Pesticide Limited, Chinhat, Lucknow), a river sediments (Gomti river sediment, Lucknow), heavy metal industry dump site (Jajmau industrial area Kanpur), a effluent treatment plant (CETP along Ganges river near Kanpur), and an oil refinery (Mathura oil refinery). Hybridization of 16S rRNA probes revealed the presence of bacteria similar to well characterized genera involved in biodegradation of pollutants. Genes involved in complete degradation pathways for hexachlorocyclohexane (lin), 1,2,4-trichlorobenzene (tcb), naphthalene (nah), phenol (mph), biphenyl (bph), benzene (ben), toluene (tbm), xylene (xyl), phthalate (pht), Salicylate (sal) and resistance to mercury (mer) were detected with highest intensity. The most abundant genes belonged to hydroxylases, monooxygenases and dehydrogenases which were present in all the five samples. Many compound specific genes which initiate the degradation pathway were also detected. Thus, the array developed and validated here may be useful in assessing the biodegradative potential and composition of environmentally useful bacteria in hazardous ecosystems. Agilent one-color CGH experiment,Organism: Genotypic designed Agilent-17159 Genotypic designed Agilent Multibacterial 8x15k Array , Labeling kit: Agilent Genomic DNA labeling Kit (Part Number: 5190-0453)
2011-04-15 | E-GEOD-24353 | biostudies-arrayexpress
Project description:Gas hydrates, also known as clathrates, are cages of ice-like water crystals encasing gas molecules such as methane (CH4). Despite the global importance of gas hydrates, their microbiomes remain mysterious. Microbial cells are physically associated with hydrates, and the taxonomy of these hydrate-associated microbiomes is distinct from non-hydrate-bearing sites. Global 16S rRNA gene surveys show that members of sub-clade JS-1 of the uncultivated bacterial candidate phylum Atribacteria are the dominant taxa in gas hydrates. The Atribacteria phylogeny is highly diverse, suggesting the potential for wide functional variation and niche specialization. Here, we examined the distribution, phylogeny, and metabolic potential of uncultivated Atribacteria in cold, salty, and high-pressure sediments beneath Hydrate Ridge, off the coast of Oregon, USA, using a combination of 16S rRNA gene amplicon, metagenomic, and metaproteomic analysis. Methods were developed to extract bacterial cellular protein from these sediments, as outlined below. Sample Description Three sediments samples were collected from beneath Hydrate Ridge, off the coast of Oregon, USA. Sediments were cored at ODP site 1244 (44°35.1784´N; 125°7.1902´W; 895 m water depth) on the eastern flank of Hydrate Ridge ~3 km northeast of the southern summit on ODP Leg 204 in 2002 and stored at -80°C at the IODP Gulf Coast Repository. E10H5 sediment is from 68.5 meters below sediment surface interface C1H2 sediment is from 2 meters below sediment surface interface. C3H4 sediment is from 21 meters below sediment surface interface.
2020-01-22 | PXD012479 | Pride
Project description:16s RNA gene sequencing data from seawater, bed sediment and steel corrosion samples from Shoreham Harbour, UK, collected to allow bacterial species comparisons between microbially influenced corrosion, the surrounding seawater, and the sea bed sediment at the seafloor and 50cm depth below seafloor.
2019-10-06 | E-MTAB-8373 | biostudies-arrayexpress
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Freshwater environments such as rivers receive effluent discharges from wastewater treatment plants, representing a potential hotspot for antibiotic resistance genes (ARGs). These effluents also contain low levels of different antimicrobials including biocides and antibiotics such as sulfonamides that can be frequently detected in rivers. The impact of such exposure on ARG prevalence and microbial diversity of riverine environment is unknown, so the aim of this study was to investigate the release of a sub-lethal concentration (<4 g L-1) of the sulfonamide compound sulfamethoxazole (SMX) on the river bacterial microbiome using a microflume system. This system was a semi-natural in-vitro microflume using river water (30 L) and sediment, with circulation to mimic river flow. A combination of ‘omics’ approaches were conducted to study the impact of SMX exposure on the microbiomes within the microflumes. Metaproteomics did not show differences in ARGs expression with SMX exposure in water.
2021-07-06 | PXD023822 | Pride
Project description:Iron-rich pelagic aggregates (iron snow) were collected directly onto silicate glass filters using an electronic water pump installed below the redoxcline. RNA was extracted and library preparation was done using the NEBNext Ultra II directional RNA library prep kit for Illumina. Data was demultiplied by GATC sequencing company and adaptor was trimmed by Trimgalore. After trimming, data was processed quality control by sickle and mRNA/rRNA sequences were sorted by SortmeRNA. mRNA sequences were blast against NCBI-non redundant protein database and the outputs were meganized in MEGAN to do functional analysis. rRNA sequences were further sorted against bacterial/archeal 16S rRNA, eukaryotic 18S rRNA and 10,000 rRNA sequences of bacterial 16S rRNA, eukaryotic 18S rRNA were subset to do taxonomy analysis.
2021-10-15 | E-MTAB-9686 | biostudies-arrayexpress