Ontology highlight
ABSTRACT:
PROVIDER: PRJNA675830 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR13017845_1.fastq.gz | Fastqsanger.gz | |||
| SRR13017845_2.fastq.gz | Fastqsanger.gz | |||
| SRR13017846_1.fastq.gz | Fastqsanger.gz | |||
| SRR13017846_2.fastq.gz | Fastqsanger.gz | |||
| SRR13017847_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 32 |
Similar Datasets
Project description:CRISPR-Cas immune systems function to defend prokaryotes against potentially harmful mobile genetic elements including viruses and plasmids. The multiple CRISPR-Cas systems (Types I, II, III) each recognize and target destruction of foreign invader nucleic acids via structurally and functionally diverse effector complexes (crRNPs). CRISPR-Cas effector complexes are comprised of CRISPR RNAs (crRNAs) that contain sequences homologous to the invading nucleic acids and Cas proteins specific to each immune system type. We have previously characterized a crRNP in Pyrococcus furiosus (Pfu) that contains Cmr proteins (Type III-B) associated with one of two primary size forms of crRNAs and functions through homology-dependent cleavage of target RNAs. In the current study, we have isolated and characterized two additional native Pfu CRISPR-Cas complexes containing either Csa (Type I-A) or Cst (Type I-G) proteins and distinct profiles of associated crRNAs. For each complex, the Cas proteins were identified by tandem mass spectrometry and immunoblotting and the crRNAs by RNA deep sequencing and Northern blot analysis. The crRNAs associated with both the Csa and Cst complexes originate from each of seven total CRISPR loci and contain identical 5’ ends (8-nt CRISPR RNA repeat-derived 5’ tag sequences) but heterogeneous 3’ ends (containing variable amounts of downstream repeat sequences). These crRNA forms are distinct from Cmr-associated crRNAs, indicating different 3’ end processing pathways following primary cleavage of common pre-crRNAs. We predict that the newly identified Pfu Type I-A (Csa) and Type I-G (Cst)-containing crRNPs, like other previously characterized Type I CRISPR-Cas effector complexes, each function by carrying out crRNA-guided DNA targeting of invading mobile genetic elements. Taken together, our in-depth characterization of the three isolated native complexes provides clear evidence for three compositionally distinct crRNPs containing either Cmr, Csa, or Cst Cas proteins that together make up an impressive arsenal of CRISPR-Cas defense for a single organism. 4 Samples: Protein-associated small RNAs
2015-07-10 | E-GEOD-65781 | biostudies-arrayexpress
Project description:We used ChIP-seq to map binding of the CRISPR surveillance complex, Cascade, in a Salmonella enterica serovar Typhimurium strain lacking the gene encoding the endonuclease Cas3. We performed ChIP-seq in strains with wild-type and mutant sequences upstream of the two CRISPR arrays, and in strains with wild-type and mutant nusE genes to determine the impact of Nus factor antitermination on CRISPR array function.
2018-10-13 | E-MTAB-7242 | biostudies-arrayexpress
Project description:CRISPR-Cas immune systems function to defend prokaryotes against potentially harmful mobile genetic elements including viruses and plasmids. The multiple CRISPR-Cas systems (Types I, II, III) each recognize and target destruction of foreign invader nucleic acids via structurally and functionally diverse effector complexes (crRNPs). CRISPR-Cas effector complexes are comprised of CRISPR RNAs (crRNAs) that contain sequences homologous to the invading nucleic acids and Cas proteins specific to each immune system type. We have previously characterized a crRNP in Pyrococcus furiosus (Pfu) that contains Cmr proteins (Type III-B) associated with one of two primary size forms of crRNAs and functions through homology-dependent cleavage of target RNAs. In the current study, we have isolated and characterized two additional native Pfu CRISPR-Cas complexes containing either Csa (Type I-A) or Cst (Type I-G) proteins and distinct profiles of associated crRNAs. For each complex, the Cas proteins were identified by tandem mass spectrometry and immunoblotting and the crRNAs by RNA deep sequencing and Northern blot analysis. The crRNAs associated with both the Csa and Cst complexes originate from each of seven total CRISPR loci and contain identical 5’ ends (8-nt CRISPR RNA repeat-derived 5’ tag sequences) but heterogeneous 3’ ends (containing variable amounts of downstream repeat sequences). These crRNA forms are distinct from Cmr-associated crRNAs, indicating different 3’ end processing pathways following primary cleavage of common pre-crRNAs. We predict that the newly identified Pfu Type I-A (Csa) and Type I-G (Cst)-containing crRNPs, like other previously characterized Type I CRISPR-Cas effector complexes, each function by carrying out crRNA-guided DNA targeting of invading mobile genetic elements. Taken together, our in-depth characterization of the three isolated native complexes provides clear evidence for three compositionally distinct crRNPs containing either Cmr, Csa, or Cst Cas proteins that together make up an impressive arsenal of CRISPR-Cas defense for a single organism.
2015-07-10 | GSE65781 | GEO
Project description:We have developed a deep sequencing method called Whole Transcriptome Target Sequencing (WTTS), which sequences the 3’ ends of polyA+ RNA. This method can simultaneously profile gene expression and alternative polyadenylation.
2016-07-22 | GSE74919 | GEO
Project description:We employed chromatin pull-down and deep sequencing to globally identify HetR DNA targets in vivo at 6 hours after fixed-nitrogen deprivation. We identified novel DNA binding targets of tagged HetR-6xHis and defined a consensus HetR binding site from these HetR target sequences.
2013-10-31 | GSE51886 | GEO
Project description:We employed chromatin pull-down and deep sequencing to globally identify HetR DNA targets in vivo at 6 hours after fixed-nitrogen deprivation. We identified novel DNA binding targets of tagged HetR-6xHis and defined a consensus HetR binding site from these HetR target sequences. Chromatin pull down of hetR mutant strain UHM103 carrying pAM4375, which expresses HetR-6xHis, and a wild-type control. One dataset was collected.
2013-10-31 | E-GEOD-51886 | biostudies-arrayexpress
Project description:The development of CRISPR-Cas systems for targeting DNA and RNA in diverse organisms has transformed biotechnology and biological research. Moreover, the CRISPR revolution has highlighted bacterial adaptive immune systems as a rich and largely unexplored frontier for discovery of new genome engineering technologies. In particular, the class 2 CRISPR-Cas systems, which use single RNA-guided DNA-targeting nucleases such as Cas9, have been widely applied for targeting DNA sequences in eukaryotic genomes. Here, we report DNA-targeting and transcriptional control with class I CRISPR-Cas systems. Specifically, we repurpose the effector complex from type I variants of class 1 CRISPR-Cas systems, the most prevalent CRISPR loci in nature, that target DNA via a multi-component RNA-guided complex termed Cascade. We validate Cascade expression, complex formation, and nuclear localization in human cells and demonstrate programmable CRISPR RNA (crRNA)-mediated targeting of specific loci in the human genome. By tethering transactivation domains to Cascade, we modulate the expression of targeted chromosomal genes in both human cells and plants. This study expands the toolbox for engineering eukaryotic genomes and establishes Cascade as a novel CRISPR-based technology for targeted eukaryotic gene regulation.
2019-06-26 | GSE114858 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:We conducted a two-vector CRISPR/Cas13d proliferation screening experiment. The screening library contains 10,830 sgRNAs targeting 192 protein-coding genes and 234 lncRNAs, and the screening experiment was performed using a melanoma cell line A375. It provides a unique dataset to model Cas13d sgRNA efficiency and specificity. We designed a deep learning model, named DeepCas13, to predict the sgRNA on-target activity with high accuracy from sgRNA sequences and RNA secondary structures.
2023-01-16 | GSE183256 | GEO