Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: mice fecal 16S rRNA High Throughput Sequencing

PROVIDER: PRJNA721957 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR14238407_1.fastq.gz	Fastqsanger.gz
	SRR14238407_2.fastq.gz	Fastqsanger.gz
	SRR14238408_1.fastq.gz	Fastqsanger.gz
	SRR14238408_2.fastq.gz	Fastqsanger.gz
	SRR14238409_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 20

Similar Datasets

Impact of fecal microbiota transplantation (FMT) in 3 days-ABX-treated recipient mice using feces from 6 NSCLC patients at diagnosis.

Project description:This study aimed to analyze changes in gut microbiota composition in mice after transplantation of fecal microbiota (FMT, N = 6) from the feces of NSCLC patients by analyzing fecal content using 16S rRNA sequencing, 10 days after transplantation. Specific-pathogen-free (SPF) mice were used for each experiments (N=4) as controls.

2023-07-01 | E-MTAB-12812 | biostudies-arrayexpress

16S rRNA sequencing of fecal samples from Atg16l1 T300A and wildtype littermate mice that were either exposed or not to mainstream cigarette smoking for 6 weeks

Project description:We found that mainstream cigarette smoking (4 cigarettes/day, 5 days/week for 2 weeks using Kentucky Research Cigarettes 3R4F) resulted in >20% decrease in the percentage of normal Paneth cell population in Atg16l1 T300A mice but showed minimal effect in wildtype littermate control mice, indicating that Atg16l1 T300A polymorphism confers sensitivity to cigarette smoking-induced Paneth cell damage. We performed 16S rRNA sequencing to identify potential microbiota changes associated with Paneth cell defect in Atg16l1 T300A mice exposed to cigarette smoking. Female mice were used at 4-5 weeks of age. Cigarette smoking was performed using smoking chamber with the dosage and schedule as described above. The fecal samples from the mice were collected for 16S rRNA sequencing analysis after completing 6 weeks of smoking.

2018-10-31 | E-MTAB-5717 | biostudies-arrayexpress

Gut microbiota dysbiosis and neurological function recovery after intracerebral hemorrhage [16S rRNA-Seq]

Project description:We aimed to investigate the microbial community composition in patients with intracerebral hemorrhage (ICH) and its effect on prognosis. The relationship between changes in bacterial flora and the prognosis of spontaneous cerebral hemorrhage was studied in two cohort studies. Fecal samples from healthy volunteers and patients with intracerebral hemorrhage were subjected to 16S rRNA sequencing at three time points: T1 (within 24 hours of admission), T2 (3 days post-surgery), and T3 (7 days post-surgery) using Illumina high-throughput sequencing technology.

2024-08-22 | E-MTAB-14351 | biostudies-arrayexpress

Chronic Strongyloides stercoralis infection increases Ruminococcus torques group and alter microbiome proteome in ivermectin treatment

Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.

2023-11-07 | PXD037975 | JPOST Repository

Nobiletin ameliorates high fat-induced disruptions in rhythmic glucagon-like peptide-1 secretion - 16S

Project description:16S rRNA gene sequencing of colonic feces from mice fed regular chow, regular chow+nobiletin, high-fat diet or high-fat diet+nobiletin.

2022-05-06 | E-MTAB-11551 | biostudies-arrayexpress

Targeting gut microbiota in Kras wild-type and G12D mutated pancreatic cancer mice

Project description:FastQ files from 16S sequencing of fecal samples from pancreatic cancer xenografted mice not treated (CTRL) and treated with chemotherapy (GEM+nab-PTX), probiotics (PRO) and chemotherapy + probiotics (GEM+nab-PTX+PRO)

2024-09-14 | E-MTAB-12171 | biostudies-arrayexpress

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Effects of semaglutide on the gut microbiota of high-fat diet-fed mice lacking GLP-1Rs in T cells

Project description:Gut intraepithelial lymphocytes (IELs) are one of the few immune cell populations in the body that expresses glucagon-like 1 receptors (GLP-1R). To test the potential effects of GLP-1 on the gut microbiota through the gut IEL GLP-1R, we performed 16s rRNA seq on the DNA isolated from the fecal pellet of Lck-Cre; Glp1rfl/fl mice (Glp1rTcell-/-) or controls (Glp1rTcell+/+) fed a high-fat diet (HFD) for 12 weeks followed by 1 week of HFD plus semaglutide (10 ug/kg) or vehicle treatment. Fecal pellets from a group of age-matched, sex-matched control mice were included as a chow control group.

2022-08-29 | GSE202452 | GEO

Changes in intestinal permeability and gut microbiota following diet-induced weight loss in patients with metabolic dysfunction-associated steatohepatitis and liver fibrosis

Project description:We explore whether a low-energy diet intervention for Metabolic dysfunction-associated steatohepatitis (MASH) improves liver disease by means of modulating the gut microbiome. 16 individuals were given a low-energy diet (880 kcal, consisting of bars, soups, and shakes) for 12 weeks, followed by a stepped re-introduction to whole for an additional 12 weeks. Stool samples were obtained at 0, 12, and 24 weeks for microbiome analysis. Fecal microbiome were measured using 16S rRNA gene sequencing. Positive control (Zymo DNA standard D6305) and negative control (PBS extraction) were included in the sequencing. We found that low-energy diet improved MASH disease without lasting alterations to the gut microbiome.

2024-12-31 | E-MTAB-14061 | biostudies-arrayexpress

Effects of chronic ingestion of soy peptide supplementation on gut microbial composition during juvenile social isolation

Project description:To investigate the effect of soy peptides on gut microial composition during juvenile social isolation, group-house (GH) and social isolation (SI) mice were fed a diet consisting of soy peptides or a control diet for 4 weeks post-weaning. We then performed microbial community analysis using data obtained from bacterial 16S rRNA gene sequencing in the fecal samples of 4 mice groups (control diet-fed GH, soy peptide-diet fed GH, control diet-fed SI, and soy peptide-diet fed SI mice).

2024-05-29 | GSE231557 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data