Ontology highlight
ABSTRACT:
PROVIDER: PRJNA724657 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:We performed 5hmC DNA Immunoprecipitation followed high-throughput sequencing using R1 ESCs, OT ESCs, TSKM ESCs, Day3 TSKM and OSKM induction cells. We compared the profiling of 5-hydroxymethylcytosine modifications in these different cell lines. We found that: the TSKM and OT iPSCs shared similar 5hmC modification pattern while apart from that of R1 ESCs. However the comparison based on the gene promoter (-1000/+500 of gene’s TSS) showed less differences. The TSKM 2nd induction samples were quite like each other and have shared the basic pattern with traditional OSKM 2nd sample. However comparison based on the gene promoter showed sharp increase. Moreover higher enrichment of 5hmC on the distal enhancer of Oct4 was specifically detected in Day 3 TSKM 2nd cells as well as TSKM and OT iPSCs, which might be helpful for us to study the Tet1-mediated somatic reprogramming. Examination of 5-hydroxymethylcytosine modifications in 5 different cell lines.
2012-11-17 | E-GEOD-33781 | biostudies-arrayexpress
Project description:Three homozygous R1 genotypes, R1-g (WT), R1-sc and r1-m3 were laser microdissected and sequenced. The data showed that in aleurone (AL), expression of R1 in R1-sc and r1-m3 is higher than R1-g, and R1 is ectopically expressed in starchy endosperm (SE) in R1-sc and r1-m3. Interestingly, the ectopic expression of R1 in SE may be associated with RNA splicing process.
2022-07-21 | GSE200905 | GEO
Project description:Recent genome-scale ChIP-chip studies of transcription factors have shown that a low percentage of experimentally determined binding sites contain the consensus motif for the immunoprecipitated factor. In most cases, differences between in vivo target sites that contain or lack a consensus motif have not been explored. We have previously shown that most sites to which E2F family members are bound in vivo do not contain E2F consensus motifs. The main purpose of this study was to develop an understanding of how E2F binding specificity is achieved in vivo. In particular, we have addressed how E2F family members are recruited to core promoter regions that lack a consensus motif and are excluded from other regions that contain a consensus motif. Using promoter and ENCODE arrays, we have shown that the predominant factors specifying whether E2F is recruited to an in vivo binding site are a) the site must be in a core promoter and b) the promoter region must be utilized as a promoter by the transcriptional machinery in that particular cell type. We have tested three models for recruitment of E2F to core promoters lacking a consensus site, including a) indirect recruitment, b) looping to the core promoter mediated by an E2F bound to a distal consensus motif, and c) assisted binding of E2F to a site that weakly resembles an E2F consensus motif within the core promoter. To test these models, we developed a new in vivo assay, termed eChIP, which allows analysis of transcription factor binding to isolated promoter fragments. Our findings suggest that in vivo a) the presence of a consensus motif is not sufficient to recruit E2Fs, b) E2Fs can bind to isolated regions that lack a consensus motif, and c) binding can require regions other than the best match to the E2F PWM in the core promoter. Keywords: E2F, ChIP-chip, transcription factor binding, consensus motifs
2008-10-01 | GSE12126 | GEO
Project description:We performed 5hmC DNA Immunoprecipitation followed high-throughput sequencing using R1 ESCs, OT ESCs, TSKM ESCs, Day3 TSKM and OSKM induction cells. We compared the profiling of 5-hydroxymethylcytosine modifications in these different cell lines. We found that: the TSKM and OT iPSCs shared similar 5hmC modification pattern while apart from that of R1 ESCs. However the comparison based on the gene promoter (-1000/+500 of gene’s TSS) showed less differences. The TSKM 2nd induction samples were quite like each other and have shared the basic pattern with traditional OSKM 2nd sample. However comparison based on the gene promoter showed sharp increase. Moreover higher enrichment of 5hmC on the distal enhancer of Oct4 was specifically detected in Day 3 TSKM 2nd cells as well as TSKM and OT iPSCs, which might be helpful for us to study the Tet1-mediated somatic reprogramming.
2012-11-17 | GSE33781 | GEO
Project description:Recent genome-scale ChIP-chip studies of transcription factors have shown that a low percentage of experimentally determined binding sites contain the consensus motif for the immunoprecipitated factor. In most cases, differences between in vivo target sites that contain or lack a consensus motif have not been explored. We have previously shown that most sites to which E2F family members are bound in vivo do not contain E2F consensus motifs. The main purpose of this study was to develop an understanding of how E2F binding specificity is achieved in vivo. In particular, we have addressed how E2F family members are recruited to core promoter regions that lack a consensus motif and are excluded from other regions that contain a consensus motif. Using promoter and ENCODE arrays, we have shown that the predominant factors specifying whether E2F is recruited to an in vivo binding site are a) the site must be in a core promoter and b) the promoter region must be utilized as a promoter by the transcriptional machinery in that particular cell type. We have tested three models for recruitment of E2F to core promoters lacking a consensus site, including a) indirect recruitment, b) looping to the core promoter mediated by an E2F bound to a distal consensus motif, and c) assisted binding of E2F to a site that weakly resembles an E2F consensus motif within the core promoter. To test these models, we developed a new in vivo assay, termed eChIP, which allows analysis of transcription factor binding to isolated promoter fragments. Our findings suggest that in vivo a) the presence of a consensus motif is not sufficient to recruit E2Fs, b) E2Fs can bind to isolated regions that lack a consensus motif, and c) binding can require regions other than the best match to the E2F PWM in the core promoter. Keywords: E2F, ChIP-chip, transcription factor binding, consensus motifs 37 ChIP-chip arrays (of these, 14 array sets are biological duplicates). 22 samples are included in this series, the rest can be found in supplementary info to the following papers: Xu 2007, Jin 2006, Komashko 2008
2008-10-01 | E-GEOD-12126 | biostudies-arrayexpress
Project description:Ronin ChIA-PET in R1 mouse ES cells.
2023-04-15 | GSE136144 | GEO
Project description:The selected gRNA sequence is tggcatgtttattgagcgctTGG. To disrupt the demethylation motif RRACT in 2288-2290 of Foxo1 mRNA (NM_019739), a mutation (ttGGACT to ctCGATT) target vector was constructed with 1214bp 5’arm and 849bp 3’arm. Mouse zygotes obtained by mating of males with superovulated C57BL/6J females, were injected with a mixture of Cas9 mRNA (80 ng/μl), sgRNA (40 ng/ul) and Donor vector (8 ng/ul). Microinjections were performed into the male pronucleus of fertilized oocytes. Injected zygotes were transferred into pseudopregnant CD1 female mice, and viable adult mice were obtained. Mice were genotyped using sequencing and PCR. PCR primers: mut-F1, ATCCCCATTGAGCAGTAAGTTTTCCA; mut-R1, TGATGGACTCCATGTCACAATCGAG; mut-F2, GCATGTTTATTGAGCGCCTCGAT; mut-R2, CCGCTGTTGCCAAGTCTGAGG; wt-R1, TGATGGACTCCATGTCACAGTCCAA. PCR genotyping of wild-type (wt) and mutant (mut) mice was using primers mut-F1 and mut-R1 to generate fragments of 1291 bp for mut allele, using primers mut-F2 and mut-R2 to generate fragments of 930 bp for mut allele, and using primers mut-F1 and wt-R1 to generate fragments of 1291 bp for wt allele. Total RNA was isolated from Liver Tissue using the TRIzol (Invitrogen) reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol.The libraries were sequenced using HiSeq3000 (Illumina) in paired-read mode, creating reads with a length of 101 bp. Sequencing chemistry v2 (Illumina) was used.
2022-01-26 | GSE125786 | GEO
Project description:Chromatin immuno-precipitation using anti-Flag (Sigma) antibodies in a U2OS stable cell line. Paired-end R1 and R2 reads are provided, but the processed (mapped) reads are from a single-end (R1 read only) mapping.
2015-12-03 | E-MTAB-3687 | biostudies-arrayexpress
Project description:We propose that multiple CTCF sites on same motif orientation could cooperate with each other for stable enhancer-promoter interactions in the β-globin locus.
2022-01-03 | GSE164288 | GEO
Project description:Comparison of human foreskin fibroblasts with different guide RNA compositions undergoing CRISPRa-mediated reprogramming. Cell samples have been collected at days 4, 8 and 12 of pluripotency induction. Each time point has three conditions with either (1) pluripotent reprogramming factor promoter targeting guides (OMKSL), (2) EEA-motif targeting guides (36bp), or reprorgamming factor promoter and EEA-motif targeting guides (OMKSL+36bp). Control samples have been collected from non-treated foreskin fibroblasts.
2018-06-07 | E-MTAB-6186 | biostudies-arrayexpress