Ontology highlight
ABSTRACT:
PROVIDER: PRJNA728558 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR14509400_1.fastq.gz | Fastqsanger.gz | |||
| SRR14509400_2.fastq.gz | Fastqsanger.gz | |||
| SRR14509401_1.fastq.gz | Fastqsanger.gz | |||
| SRR14509401_2.fastq.gz | Fastqsanger.gz | |||
| SRR14509402_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 346 |
Similar Datasets
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
2017-05-12 | PXD006118 | Pride
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
2022-03-01 | PXD009773 | Pride
Project description:Tropical Low-DO OA Reactor 16S rRNA Amplicon Sequencing
| PRJNA588111 | ENA
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:The characterization of microbial community structure via 16S rRNA gene profiling has been greatly advanced in recent years by the application of amplicon pyrosequencing. The possibility of barcode-tagged sequencing of templates gives the opportunity to massively screen multiple samples from environmental or clinical sources for community details. However, an on-going debate questions the reproducibility and semi-quantitative rigour of pyrotag sequencing and, as in the early days of genetic community fingerprinting, pros and cons are continuously provided. In this study we investigate the reproducibility of bacterial 454 pyrotag sequencing over biological and technical replicates of natural microbiota. Moreover, via quantitatively defined template spiking to the natural community, we explore the potential for recovering specific template ratios within complex microbial communities. For this reason, we pyrotag sequenced three biological replicates of three samples, each belonging from yearly sampling campaigns of sediment from a tar oil contaminated aquifer in Düsseldorf, Germany. Furthermore, we subjected one DNA extract to replicate technical analyses as well as to increasing ratios (0, 0.2, 2 and 20%) of 16S rRNA genes from a pure culture (Aliivibrio fisheri) originally not present in the sample. Unexpectedly, taxa abundances were highly reproducible in our hands, with max standard deviation of ~3% abundance across biological and ~2% for technical replicates. Furthermore, our workflow was also capable of recovering A. fisheri amendmend ratios in reliable amounts (0, 0.29, 3.9 and 23.8%). These results highlight that pyrotag sequencing, if done and evaluated with due caution, has the potential to robustly recapture taxa template abundances within environmental microbial communities. 9 Biological and 3 technical replicates were evaluated, as well as potential to recover qPCR-defined ratios of DNA, in 454 pyrotag sequencing
2012-07-16 | E-GEOD-35631 | biostudies-arrayexpress
Project description:The association between soil microbes and plant roots is present in all natural and agricultural environments. Microbes can be beneficial, pathogenic, or neutral to the host plant development and adaptation to abiotic or biotic stresses. Progress in investigating the functions and changes in microbial communities in diverse environments have been rapidly developing in recent years, but the changes in root function is still largely understudied. The aim of this study was to determine how soil bacteria influence maize root transcription and microRNAs (miRNAs) populations in a controlled inoculation of known microbes over a defined time course. At each time point after inoculation of the maize inbred line B73 with ten bacterial isolates, DNA and RNA were isolated from roots. The V4 region of the 16S rRNA gene was amplified from the DNA and sequenced with the Illumina MiSeq platform. Amplicon sequencing of the 16S rRNA gene indicated that most of the microbes successfully colonized maize roots. The colonization was dynamic over time and varied with the specific bacterial isolate. Small RNA sequencing and mRNA-Seq was done to capture changes in the root transcriptome from 0.5 to 480 hours after inoculation. The transcriptome and small RNA analyses revealed epigenetic and transcriptional changes in roots due to the microbial inoculation. This research provides the foundational data needed to understand how plant roots interact with bacterial partners and will be used to develop predictive models for root response to bacteria.
2023-05-01 | GSE214656 | GEO
Project description:The characterization of microbial community structure via 16S rRNA gene profiling has been greatly advanced in recent years by the application of amplicon pyrosequencing. The possibility of barcode-tagged sequencing of templates gives the opportunity to massively screen multiple samples from environmental or clinical sources for community details. However, an on-going debate questions the reproducibility and semi-quantitative rigour of pyrotag sequencing and, as in the early days of genetic community fingerprinting, pros and cons are continuously provided. In this study we investigate the reproducibility of bacterial 454 pyrotag sequencing over biological and technical replicates of natural microbiota. Moreover, via quantitatively defined template spiking to the natural community, we explore the potential for recovering specific template ratios within complex microbial communities. For this reason, we pyrotag sequenced three biological replicates of three samples, each belonging from yearly sampling campaigns of sediment from a tar oil contaminated aquifer in Düsseldorf, Germany. Furthermore, we subjected one DNA extract to replicate technical analyses as well as to increasing ratios (0, 0.2, 2 and 20%) of 16S rRNA genes from a pure culture (Aliivibrio fisheri) originally not present in the sample. Unexpectedly, taxa abundances were highly reproducible in our hands, with max standard deviation of ~3% abundance across biological and ~2% for technical replicates. Furthermore, our workflow was also capable of recovering A. fisheri amendmend ratios in reliable amounts (0, 0.29, 3.9 and 23.8%). These results highlight that pyrotag sequencing, if done and evaluated with due caution, has the potential to robustly recapture taxa template abundances within environmental microbial communities.
2012-07-16 | GSE35631 | GEO
Project description:Two-stage two-phase biogas reactor systems consisting each of one batch downflow hydrolysis reactor (HR, vol. 10 L), one process fluid storage tank (vol. 10 L), and one downstream upflow anaerobic filter reactor (AF, vol. 10 L), were operated at mesophilic (M, 37 °C) and thermophilic (T, 55 °C) temperatures and over a period of > 750 d (Figure 1, Additional file 1). For each reactor system and for each process temperature, two replicates were conducted in parallel, denominated further as biological replicates. Further process details were as previously published. Start-up of all fermenters were performed using liquid fermenter material from a biogas plant converting cattle manure in co-digestion with grass and maize silage and other biomass at varying concentrations and at mesophilic temperatures. Silage of perennial ryegrass (Lolium perenne L.) was digested as sole substrate in batches of varying amounts with retention times of 28 d (storage of bale silage at -20 °C, cutting length 3 cm, volatile substances (VS) 32 % of fresh mass (FM), total Kjeldahl nitrogen 7.6 g kgFM-1, NH4+-N 0.7 g kgFM-1, acetic acid 2.6 g kgFM-1, propionic acid < 0.04 g kgFM-1, lactic acid 2.6 g kgFM-1, ethanol 2.2 g kgFM-1, C/N ratio 19.3, chemical oxygen demand (COD) 357.7 g kgFM-1, analysis of chemical properties according to [6]. No spoilage was observed in the silage. Biogas yields were calculated as liters normalized to 0 °C and 1013 hPa (LN) per kilogram volatile substances (kgVS). For chemical analysis, samples were taken from the effluents of HR and AF. For sequencing of 16S rRNA gene amplicon libraries, microbial metagenomes, and microbial metatranscriptomes, samples were taken from the silage digestate in the HR digested for 2 d. At this time point, high AD rates were detected as indicated by the fast increase of volatile fatty acids (VFA), e.g., acetic acid. Sampling was performed at two different organic loading rates (OLR), i.e., batch-fermentation of 500 g (denominated as “low OLR”, samples MOLR500 and TOLR500) and 1,500 g silage (denominated as “increased OLR”, samples MOLR1500 and TOLR1500).
2019-04-19 | E-MTAB-7533 | biostudies-arrayexpress