Tequatrovirus T4
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA737295 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR14806812_1.fastq.gz | Fastqsanger.gz | |||
| SRR14806812_2.fastq.gz | Fastqsanger.gz | |||
| SRR14806813_1.fastq.gz | Fastqsanger.gz | |||
| SRR14806813_2.fastq.gz | Fastqsanger.gz | |||
| SRR14806814_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 62 |
Similar Datasets
Project description:CRISPR/Cas engineered Escherichia virus T4 long-read amplicon raw sequence reads
| PRJNA952186 | ENA
Project description:Microarray Analysis of Gene Expression during Bacteriophage T4 Infection
| PRJNA93685 | ENA
Project description:Autoinhibition of a clamp-loader ATPase revealed by deep mutagenesis and cryo-EM
| PRJNA1025274 | ENA
Project description:Morus alba L. Raw protein sequence reads and sequence
2024-02-08 | PXD049451 |
Project description:IntroductionBacteriophages infecting human pathogens have been considered potential biocontrol agents, and studying their genetic content is essential to their safe use in the food industry. Tequatrovirus ufvareg1 is a bacteriophage named UFV-AREG1, isolated from cowshed wastewater and previously tested for its ability to inhibit Escherichia coli O157:H7.MethodsT. ufvareg1 was previously isolated using E. coli O157:H7 (ATCC 43895) as a bacterial host. The same strain was used for bacteriophage propagation and the one-step growth curve. The genome of the T. ufvareg1 was sequenced using 305 Illumina HiSeq, and the genome comparison was calculated by VIRIDIC and VIPTree.ResultsHere, we characterize its genome and compare it to other Tequatrovirus. T. ufvareg1 virions have an icosahedral head (114 x 86 nm) and a contracted tail (117 x 23 nm), with a latent period of 25 min, and an average burst size was 18 phage particles per infected E. coli cell. The genome of the bacteriophage T. ufvareg1 contains 268 coding DNA sequences (CDS) and ten tRNA genes distributed in both negative and positive strains. T. ufvareg1 genome also contains 40 promoters on its regulatory regions and two rho-independent terminators. T. ufvareg1 shares an average intergenomic similarity (VIRIDC) of 88.77% and an average genomic similarity score (VipTree) of 88.91% with eight four reference genomes for Tequatrovirus available in the NCBI RefSeq database. The pan-genomic analysis confirmed the high conservation of Tequatrovirus genomes. Among all CDS annotated in the T. ufvareg1 genome, there are 123 core genes, 38 softcore genes, 94 shell genes, and 13 cloud genes. None of 268 CDS was classified as being exclusive of T. ufvareg1.ConclusionThe results in this paper, combined with other previously published findings, indicate that T. ufvareg1 bacteriophage is a potential candidate for food protection against E. coli O157:H7 in foods.
| S-EPMC10236363 | biostudies-literature
Project description:Purpose: We investigated how deletion of DksA or ppGpp, two E. coli global transcription regulators, affects T4 infection. Method: B606, B606 DdksA, and B606 ppGpp0 were grown at 37C to early/mid log phase (OD600 ~ 0.4) then infected with moi of 10 of either wt T4 or T4motAam and total RNA was isolated. 2.5 µg total RNA from each sample was treated with a Ribo-Zero rRNA Removal Kit (Gram-Negative Bacteria; Illumina San Diego, CA) to deplete rRNA. The enriched mRNA was fragmented, reverse-transcribed, ligated with dual indexes, and amplified using a TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). The resulting RNA-Seq libraries were pooled at equal concentrations and sequenced using on an Illumina MiSeq to generate 2 x 100 bp paired-end reads. Read data in fastq format was demultiplexed and aligned to E. coli B str. DE3 (NC_012971.2) reference genome using STAR v2.5.2, retaining unmapped reads (Dobin, Davis et al. 2013). Unmapped reads were then mapped in a second step to T4 reference (NC_000866.4). In both cases, default alignment behavior was altered with the following arguments: --outFilterScoreMinOverLread 0 --outFilterMatchNmin 30 --outFilterMatchNminOverLread 0 --clip3pAdapterSeq AGATCGGAAGAGCGTCGTGTA --alignIntronMax 1. RNA gene counts in both reference genomes were then quantified using the same NCBI gene definitions utilized in mapping index construction using the subread featureCounts v1.4.6-p3 package (Liao, Smyth et al. 2014). Differential expression between samples fchanges in gene expression was predetermined to entail a fold change of more than or equal to 2 and P value less than or equal to 0.05. at 5 minutes post-infection. Result: Both ppGpp0 and delta(dksA) increase wt T4 plaque size. However, ppGpp0 does not significantly alter burst size/latent period and only modestly affects T4 transcript abundance, while delta(dskA) increases burst size (2-fold), does not affect latent period, and increases the abundance of several Pe RNAs at 5 min post-transcription. delta(dskA) also increases T4motAam plaque size with a much shorter latent period compared to T4motAam/wt infection, and the levels of specific middle RNAs increase due to more transcription from Pe's that extend into these middle genes. Conclusion: We conclude that DksA attenuates T4 early gene expression. Consequently, delta(dksA) results in a more productive wt infection and ameliorates the poor expression of middle genes in a T4motAam infection.
2018-03-15 | GSE111808 | GEO
Project description:Bacillus sp. T4(2021) Raw sequence reads
| PRJNA790699 | ENA