Ontology highlight
ABSTRACT:
PROVIDER: PRJNA751752 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR15338700_1.fastq.gz | Fastqsanger.gz | |||
| SRR15338700_2.fastq.gz | Fastqsanger.gz | |||
| SRR15338701_1.fastq.gz | Fastqsanger.gz | |||
| SRR15338701_2.fastq.gz | Fastqsanger.gz | |||
| SRR15338702_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 194 |
Similar Datasets
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:We characterized the bacterial diversity of chlorinated drinking water from three surface water treatment plants supplying the city of Paris, France. For this purpose, we used serial analysis of V6 ribosomal sequence tag (SARST-V6) to produce concatemers of PCR-amplified ribosomal sequence tags (RSTs) from the V6 hypervariable region of the 16S rRNA gene for sequence analysis. Using SARST-V6, we obtained bacterial profiles for each drinking water sample, demonstrating a strikingly high degree of biodiversity dominated by a large collection of low-abundance phylotypes. In all water samples, between 57.2-77.4% of the sequences obtained indicated bacteria belonging to the Proteobacteria phylum. Full-length 16S rDNA sequences were also generated for each sample, and comparison of the RSTs with these sequences confirmed the accurate assignment for several abundant bacterial phyla identified by SARST-V6 analysis, including members of unclassified bacteria, which account for 6.3-36.5% of all V6 sequences. These results suggest that these bacteria may correspond to a common group adapted to drinking water systems. The V6 primers used were subsequently evaluated with a computer algorithm to assess their hybridization efficiency. Potential errors associated with primer-template mismatches and their impacts on taxonomic group detection were investigated. The biodiversity present in all three drinking water samples suggests that the bacterial load of the drinking water leaving treatment plants may play an important role in determining the downstream community dynamics of water distribution networks. 3 different drinking water samples (Orly, Ivry, Joinville drinking water sample)
2009-01-07 | E-GEOD-14318 | biostudies-arrayexpress
Project description:Opioids such as morphine have many beneficial properties as analgesics, however, opioids may induce multiple adverse gastrointestinal symptoms. We have recently demonstrated that morphine treatment results in significant disruption in gut barrier function leading to increased translocation of gut commensal bacteria. However, it is unclear how opioids modulate the gut homeostasis. By using a mouse model of morphine treatment, we studied effects of morphine treatment on gut microbiome. We characterized phylogenetic profiles of gut microbes, and found a significant shift in the gut microbiome and increase of pathogenic bacteria following morphine treatment when compared to placebo. In the present study, wild type mice (C57BL/6J) were implanted with placebo, morphine pellets subcutaneously. Fecal matter were taken for bacterial 16s rDNA sequencing analysis at day 3 post treatment. A scatter plot based on an unweighted UniFrac distance matrics obtained from the sequences at OTU level with 97% similarity showed a distinct clustering of the community composition between the morphine and placebo treated groups. By using the chao1 index to evaluate alpha diversity (that is diversity within a group) and using unweighted UniFrac distance to evaluate beta diversity (that is diversity between groups, comparing microbial community based on compositional structures), we found that morphine treatment results in a significant decrease in alpha diversity and shift in fecal microbiome at day 3 post treatment compared to placebo treatment. Taxonomical analysis showed that morphine treatment results in a significant increase of potential pathogenic bacteria. Our study shed light on effects of morphine on the gut microbiome, and its role in the gut homeostasis.
2018-04-16 | E-MTAB-5546 | biostudies-arrayexpress
Project description:We used phylogenetic low-density microarrays targeting the 16S rRNA gene to characterize the gingival flora of acute noma and acute necrotizing gingivitis lesions, and compared them to healthy control subjects of the same geographical and social background. Various types of samples were collected (column characteristics); patients from the same hospital without mouth infection (H), matched control populations (T), patients suffering gengivitis (Gengivitis), patient suffering NOMA (noma), patient suffering NOMA receiving antimicrobials (N-ATB). Sampled from patients were retrieved from both sides (column Description); healthy- or lesion-side of the mouth. All controls are matched with specific patients (see column patient category and number) We designed low-density 16S rDNA arrays representing 339 different phylotypes. We used an arbitrary cutoff of 1% of overall abundance to select from this dataset the most abundant sequences for probe design. Using this cutoff, the 132 most abundant 16S rRNA gene sequences were scanned for probes respecting defined physico-chemical properties (Tm = 65M-BM-15M-BM-0C; probe length = 23M-bM-^@M-^S50 nt; < -5.0 kcal/mol for hairpins; < -8.0 kcal/mol for self-dimers; and dinucleotide repeats shorter than 5 bp) using a commercial software (Array Designer TM 2.0 by Premier Biosoft). The 335 oligonucleotide probes were synthesized with a C6-linker with free primary amine (Sigma-Aldrich) and spotted on ArrayStrips microarrays (Clondiag GmbH, Jena, Germany).
2013-12-27 | E-GEOD-43612 | biostudies-arrayexpress
Project description:We characterized the bacterial diversity of chlorinated drinking water from three surface water treatment plants supplying the city of Paris, France. For this purpose, we used serial analysis of V6 ribosomal sequence tag (SARST-V6) to produce concatemers of PCR-amplified ribosomal sequence tags (RSTs) from the V6 hypervariable region of the 16S rRNA gene for sequence analysis. Using SARST-V6, we obtained bacterial profiles for each drinking water sample, demonstrating a strikingly high degree of biodiversity dominated by a large collection of low-abundance phylotypes. In all water samples, between 57.2-77.4% of the sequences obtained indicated bacteria belonging to the Proteobacteria phylum. Full-length 16S rDNA sequences were also generated for each sample, and comparison of the RSTs with these sequences confirmed the accurate assignment for several abundant bacterial phyla identified by SARST-V6 analysis, including members of unclassified bacteria, which account for 6.3-36.5% of all V6 sequences. These results suggest that these bacteria may correspond to a common group adapted to drinking water systems. The V6 primers used were subsequently evaluated with a computer algorithm to assess their hybridization efficiency. Potential errors associated with primer-template mismatches and their impacts on taxonomic group detection were investigated. The biodiversity present in all three drinking water samples suggests that the bacterial load of the drinking water leaving treatment plants may play an important role in determining the downstream community dynamics of water distribution networks.
2009-01-08 | GSE14318 | GEO
Project description:16S rDNA amplicon sequencing of 196 human fecal samples of an Inulin cross-over trial in healthy, mildly constipated individuals.
| EGAD00001004956 | EGA
Project description:In S. cerevisiae, replication timing is controlled by epigenetic mechanisms restricting the accessibility of origins to limiting initiation factors. About 30% of these origins are located within repetitive DNA sequences such as the ribosomal DNA (rDNA) array, but their regulation is poorly understood. Here, we have investigated how histone deacetylases (HDACs) control the replication program in budding yeast. This analysis revealed that two HDACs, Rpd3 and Sir2, control replication timing in an opposite manner. Whereas Rpd3 delays initiation at late origins, Sir2 is required for the timely activation of early origins. Moreover, Sir2 represses initiation at rDNA origins whereas Rpd3 counteracts this effect. Remarkably, deletion of SIR2 restored normal replication in rpd3 cells by reactivating rDNA origins. Together, these data indicate that HDACs control the replication timing program in budding yeast by modulating the ability of repeated origins to compete with single-copy origins for limiting initiation factors. BrdU-IP-seq analysis of origin activity in wt, sir2 and rpd3 cells, aligned against genomic DNA (sacCer3) and rDNA sequences Please note that the wt WCE #1 and #2 samples are whole-cell extracts from wild-type cells arrested in HU that were used to calculate the log ratio of the BrdU IP #1 and #2 batches, respectively.
2014-05-14 | E-GEOD-57617 | biostudies-arrayexpress
Project description:Firs 1106 16S rDNA data for the Flemish Gut Flora Project
| EGAD00001001936 | EGA