Ontology highlight
ABSTRACT:
PROVIDER: PRJNA787448 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR17179475_1.fastq.gz | Fastqsanger.gz | |||
| SRR17179475_2.fastq.gz | Fastqsanger.gz | |||
| SRR17179476_1.fastq.gz | Fastqsanger.gz | |||
| SRR17179476_2.fastq.gz | Fastqsanger.gz | |||
| SRR17179477_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 20 |
Similar Datasets
Project description:We found that mainstream cigarette smoking (4 cigarettes/day, 5 days/week for 2 weeks using Kentucky Research Cigarettes 3R4F) resulted in >20% decrease in the percentage of normal Paneth cell population in Atg16l1 T300A mice but showed minimal effect in wildtype littermate control mice, indicating that Atg16l1 T300A polymorphism confers sensitivity to cigarette smoking-induced Paneth cell damage. We performed cohousing experiments to test if Paneth cell phenotype is horizontally transmissible as is microbiota. Atg16l1 T300A and littermate controls that were exposed to cigarette smoking were used as microbiota donors, and these donor mice were exposed to smoking for 2 weeks prior to cohousing. Separate groups of Atg16l1 T300A and littermate controls that were not exposed to cigarette smoking were used as microbiota recipients. The microbiota recipients were co-housed with microbiota donors of the same genotype for 4 weeks, during this period the donors continued to be exposed to cigarette smoking. Cigarette smoking was performed using smoking chamber with the dosage and schedule as described above. At the end of the experiment, the fecal microbiota composition was analyzed by 16S rRNA sequencing.
2018-10-31 | E-MTAB-5720 | biostudies-arrayexpress
Project description:v3-v4 16S rRNA sequencing was used to characterize both gut and oral microbiota composition of RCC (refractory chronic cough) patients and matched healthy controls (HC). The groups are matched in age and gender.
2024-04-17 | GSE240646 | GEO
Project description:To determine microbiota composition associated with loss of KDM5 in intestine, we carried out 16S rRNA seq analyses of dissected intestine from wildtype and kdm5 mutant. [GSM2628181-GSM2628190]. A total of 78 operational taxonomic units (OTUs) were identified in the sequence data. There were about 15 genera much less abundant in kdm5 mutant compared to wildtype. The kdm5 mutant were sensitive to pathogen. To confirm the microbiota associated with loss of KDM5 in intestine, 16S rRNA of new flies were sequenced and analyzed by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China) [GSM3243472-GSM3243481]. A total of 107 operational taxonomic units (OTUs) were identified in the sequence data. There were about 20 genera much less abundant in kdm5 mutant compared to wildtype. To confirm the microbiota associated with loss of KDM5 drosophila feeding with Lactobacillus plantarum, 16S rRNA of kdm5 mutant flies were sequenced and analyzed by Novogene Bioinformatics Technology Co., Ltd. (Tianjin, China) [GSM3263522-GSM3263527]. A total of 92 operational taxonomic units (OTUs) were identified in the sequence data. To confirm the microbiota associated with KDM5 knockdown in intestine, 16S rRNA of Myo1A-Gal4TS/+ and Myo1A-Gal4TS/+;+/kdm5RNAi flies were sequenced and analyzed by Biomarker Co. Ltd. (Beijing, China). [GSM3507915-GSM3507924]. A total of 50 operational taxonomic units (OTUs) were identified in the sequence data. There was a significant different based on the genus level between two groups.
2019-02-08 | GSE98944 | GEO
Project description:<p>In this study, we investigated the role of the gut microbiota on the development of complications in kidney transplant recipients. We collected serial fecal specimens from 168 kidney transplant recipients within the first 3 months after transplantation. We performed 16S rRNA gene sequencing of the V4-V5 hypervariable region and examined whether the relative gut abundance of pathogenic bacteria was associated with future development of complications like bacteriuria and urinary tract infections. In a subset of samples, we performed metagenomic sequencing of stool and urine supernatant specimens to determine strain level analysis. </p>
| phs001879 | dbGaP
Project description:16s rRNA sequencing of fecal samples from Anorexia donors and germ-free mice recipients
| PRJEB60103 | ENA
Project description:16S rRNA gene sequencing of colonic feces from mice fed regular chow, regular chow+nobiletin, high-fat diet or high-fat diet+nobiletin.
2022-05-06 | E-MTAB-11551 | biostudies-arrayexpress
Project description:Being able to identify patients in whom immunological tolerance has been established or is developing would allow an individually tailored approach to post-transplant management of kidney allograft recipients. Ex vivo immunological monitoring was performed on samples from five groups of European renal transplant recipients (“IOT samples”): ten drug-free tolerant recipients who were functionally stable despite remaining immunosuppression-free for more than one year (Tol-DF); also functionally stable patients on minimal immunosuppression (<10 mg/day prednisone, s-LP); stable patients maintained with calcineurin inhibitors (s-CNI); stable patients maintained on CNI-free immunosuppression regimen (s-nCNI); patients showing signs of chronic rejection (CR) and healthy controls (HC). Among the investigation of other biomarkers and bioassays, gene expression profiles were generated on custom Agilent 8x15K 60mer oligonucleotide microarrays (“RISET 2.0”) on the IOT cohort (training set) and on an independent cohort of patients from the ITN (USA) that contained similar groups of patients and included 23 tolerant recipients (“ITN samples”, test set). Set of genes were identified, whose expression on whole blood allowed the identification of 100% of the tolerant recipients in the training set and 84% in the test set. Keywords: classification of clinical samples, tolerance prediction IOT samples: 13 samples from 10 Tol-DF patients, 16 samples from 11 s-LP patients, 8 samples from 8 s-nCNI patients, 40 samples from 28 s-CNI patients, 10 samples from 9 CR patients, and 8 samples from 8 HC donors were analysed on a custom Agilent 8x15K 60mer oligonucleotide microarray encomprising 5069 probes in triplicates. The microarray is dedicated to transplantation research and was designed based on current literature and published and unpublished data provided by the RISET consortium. For the probe selection procedure we specially focused on the detection of multiple transcript variants of a gene, on optimized hybridization properties of the probes, and on the avoidance of crosshybridization. The sampling dates of replicate samples from the same patient range from one day to 1.5 years. ITN samples: 31 samples from 23 Tol-DF patients, 14 samples from 11 s-LP patients, 52 samples from 34 s-CNI patients, 25 samples from 18 CR patients, and 20 samples from 20 HC donors were analysed on the same microarray platform and served as test set. The samples of the two cohorts differ in the protocol of RNA preparation.
2010-05-25 | E-GEOD-14655 | biostudies-arrayexpress
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Here we report 16s rRNA data in gut microbiota of hepatocellular carcinoma (HCC) patients with HBV induced HCC (HBVC) and non-HBV induced HCC (NHBVC) compared with healthy volunteers. A total of 2047 operational taxonomic units (OTUs) were identified in the sequence data. Our data shows that the NHBVC patients harbor lower anti-inflammatory bacteria and more pro-inflammatory bacteria, while the HBVC patients harbor more anti-inflammatory bacteria.
2019-02-27 | GSE108847 | GEO