Homo sapiens
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA792997 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR17634900.fastq.gz | Fastqsanger.gz | |||
| SRR17634900_1.fastq.gz | Fastqsanger.gz | |||
| SRR17634900_2.fastq.gz | Fastqsanger.gz | |||
| SRR17635000.fastq.gz | Fastqsanger.gz | |||
| SRR17635000_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 789 |
Similar Datasets
Project description:In principle, whole-genome sequencing (WGS) of the human genome even at low coverage offers higher resolution for genomic copy number variation (CNV) detection compared to array-based technologies, which is currently the first-tier approach in clinical cytogenetics. There are, however, obstacles in replacing array-based CNV detection with that of low-coverage WGS such as cost, turnaround time, and lack of systematic performance comparisons. With technological advances in WGS in terms of library preparation, instrument platforms, and data analysis algorithms, obstacles imposed by cost and turnaround time are fading. However, a systematic performance comparison between array and low-coverage WGS-based CNV detection has yet to be performed. Here, we compared the CNV detection capabilities between WGS (short-insert, 3kb-, and 5kb-mate-pair libraries) at 1X, 3X, and 5X coverages and standardly used high-resolution arrays in the genome of 1000-Genomes-Project CEU genome NA12878. CNV detection was performed using standard analysis methods, and the results were then compared to a list of Gold Standard NA12878 CNVs distilled from the 1000-Genomes Project. Overall, low-coverage WGS is able to detect drastically more (approximately 5 fold more on average) Gold Standard CNVs compared to arrays and is accompanied with fewer CNV calls without secondary validation. Furthermore, we also show that WGS (at ≥1X coverage) is able to detect all seven validated deletions larger than 100 kb in the NA12878 genome whereas only one of such deletions is detected in most arrays. Finally, we show that the much larger 15 Mbp Cri-du-chat deletion can be clearly seen at even 1X coverage from short-insert WGS.
2018-06-26 | GSE105092 | GEO
Project description:This submission includes the complete set of raw data generated from the analytical standard, the concept of which is described in our manuscript "Proteome-Scale Recombinant Standards And A Robust High-Speed Search Engine To Advance Cross-Linking MS-Based Interactomics". In this study, we develop a strategy to generate a well-controlled XL-MS standard by systematically mixing and cross-linking recombinant proteins. The standard can be split into independent datasets, each of which has the MS2-level complexity of a typical proteome-wide XL-MS experiment. This submission includes 5 raw datasets (batches 1-5), each comprising 64 randomly selected human proteins engaging in up to 224 allowed protein-protein interactions per dataset. The data were searched with Scout (v. 1.4.14, https://github.com/diogobor/Scout) and results are reported in mzIdentML 1.2.0 format. For the specific results reported in our original publication, please refer to PXD042173.
2024-08-06 | PXD042173 | Pride
Project description:Three-dimensional imaging mass spectrometry (3D imaging MS) is a technique of analytical chemistry for 3D molecular analysis of a tissue specimen, entire organ, or microbial colonies on an agar plate. 3D imaging MS has unique advantages over existing 3D imaging techniques, offers novel perspectives for understanding the spatial organization of biological processes, and has growing potential to be introduced into routine use in both biology and medicine. Due to the sheer quantity of data generated, visualization, analysis, and interpretation of 3D imaging MS data remain a significant challenge. Bioinformatics research in this field is hampered by the lack of publicly available benchmark datasets needed for evaluation and comparison of algorithms. Findings We acquired high-quality 3D imaging MS datasets from different biological systems at several labs, supplied them with overview images and scripts demonstrating how to read them, and deposited them into MetaboLights, an open repository for metabolomics data. 3D imaging MS data was collected from five samples using two types of 3D imaging MS. 3D Matrix-Assisted Laser Desorption/Ionization (MALDI) imaging MS data was collected from murine pancreas, murine kidney, human oral squamous cell carcinoma, and interacting microbial colonies cultured in Petri dishes. 3D Desorption Electrospray Ionization (DESI) imaging MS data was collected from a human colorectal adenocarcinoma. Conclusions With the aim to stimulate computational research in the field of computational 3D imaging MS, we provided selected high-quality 3D imaging MS datasets which can be used by algorithm developers as benchmark datasets.
2016-07-27 | MTBLS176 | MetaboLights
Project description:Chromosomal copy number variations (CNV) have been associated with various neurological and developmental disorders and chromosomal microarray (CMA) is a method of choice to diagnose Copy Number Gain/Loss syndromes. Recently, next-generation sequencing (NGS)-based low-coverage whole genome sequencing (LC-WGS) has been applied to detect Copy Number Gain/Loss syndromes. This dataset is intended to be used as a “Golden standard data set” for development of LC-WGS analysis method. It consists of patients (n=63) who have a mental delay and/or physical disability phenotype and normal (n=20) phenotype.
2018-09-29 | GSE120624 | GEO
Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.
2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress
Project description:The presented approach is a combination of analytical flow rate chromatography with ion mobility separation of peptide ions, data-independent acquisition, and raw data processing using the DIA-NN software suite, to conduct fast, low-cost proteomic experiments that only require moderate sample amounts. The present dataset contains a series of benchmarks. Specifically, a dilution series of a K562 digest standard acquired using 5-minute and 3-minute chromatographic gradients, as well as a mixed-species human–E.coli benchmark for quantitative performance. We further demonstrate the application of the proposed approach to the analysis of plasma proteomes of COVID-19 patients, using a 3-minute gradient acquisition on a dual-column liquid chromatography system at a throughput of 398 samples/day.
2023-07-03 | PXD040205 | Pride
Project description:A natural way to benchmark the performance of an analytical experimental setup is to use samples of known content, and see to what degree one can correctly infer the content of such a sample from the data. For shotgun proteomics, one of the inherent problems of interpreting data is that the measured analytes are peptides and not the actual proteins themselves. As some proteins share proteolytic peptides, there might be more than one possible causative set of proteins resulting in a given set of peptides. Hence, there is a need for mechanisms that infer proteins from a list of detected peptides. Today's commercially available samples of known content do not expose these complications in protein inference, as their contained proteins deliberately are selected for producing tryptic peptides that are unique to a single protein. For a realistic benchmark of protein inference procedures, there is, therefore, a need for samples of known content where the present proteins share peptides with known absent proteins. Here, we present such a standard, based on E. coli expressed protein fragments.
2017-12-12 | PXD008425 | Pride
Project description:This repository is related to the work "Benchmarking commonly usedsoftware suites and analysis workflows for DIA proteomics and phosphoproteomics". The following files are stored here: 1. four MS datasets generated in this work, including two two-species benchmark datasets acquired on QE HF and timsTOF Pro, and two TNF-alpha induced phosphoproteomics datasets acquired on QE HF-X and timsTOF Pro; 2. all spectral libraries used in this work; 3. raw MS data search reports with analysis logs included if software reported; 4. preprocessed MS data search reports for any result from HF and TIMS DIA benchmark datasets; 5. FASTAs used in this work; 6. a description file (Description_of_iProX_and_public_data.xlsx) for the stored files in this repository and other public data used in this work. Note: 3 and 4 are packed into one zip file for each data search experiment.
2022-12-08 | PXD034709 |
Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to assess the reproducibility of small RNA datasets produced using Illumina sequencing-by-synthesis technology (SBS).
2009-06-03 | GSE14694 | GEO