Ontology highlight
ABSTRACT:
PROVIDER: PRJNA796642 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR17611250_1.fastq.gz | Fastqsanger.gz | |||
| SRR17611250_2.fastq.gz | Fastqsanger.gz | |||
| SRR17611251_1.fastq.gz | Fastqsanger.gz | |||
| SRR17611251_2.fastq.gz | Fastqsanger.gz | |||
| SRR17611252_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 99 |
Similar Datasets
Project description:To interrogate single-base resolution 6mA sites in the genome-wide, we develop DA-6mA-seq (DpnI-Assisted N6-methylAdenine sequencing), an optimized sequencing method taking advantage of restriction enzyme DpnI, which exclusively cleaves methylated adenine sites. We find DpnI also recognizes other sequence motifs besides the canonical GATC restriction sites, largely expanding the application range of this method. DA-6mA-seq requires less starting material and lower sequencing depth than previous methods, but achieves higher sensitivity, providing a good strategy to identify 6mA in large genome with a low abundance of 6mA. We rebuild the 6mA maps of Chlamydomonas by DA-6mA-seq and then apply this method to another two eukaryotic organisms, Plasmodium and Penicillium. Further analysis reveals most 6mA sites are symmetric at various sequence contexts, suggesting 6mA may function as a new heritable epigenetic mark in eukaryotes. A new sequencing method is developed to detect 6mA in eukaryotes
2016-04-12 | E-GEOD-74430 | biostudies-arrayexpress
Project description:We recently developed CHANGE-seq (Circularization for High-throughput Analysis of Nuclease Genome-wide Effects by Sequencing), a fast, streamlined, Tn5 tagmentation-based assay for measuring the genome-wide activity of Cas9 in vitro that is easily scalable to many targets and samples. In this study, we directly compare CIRCLE-seq to CHANGE-seq and systematically evaluate Cas9 genome-wide activity on 110 targets across 13 therapeutically-relevant loci leveraging CHANGE-seq. We validate the sensitivity of CHANGE-seq for identifying sites of bona fide cellular off-target mutations using GUIDE-seq and sensitive targeted tag sequencing. Additionally, we sought to evaluate the impact of chromatin accessibility on cellular off-target activity by comparing CHANGE-seq with matched GUIDE-seq cellular off-target, chromatin, and transcriptional profiles generated from the same human primary T-cells.
2020-09-22 | GSE149361 | GEO
Project description:We recently developed CHANGE-seq (Circularization for High-throughput Analysis of Nuclease Genome-wide Effects by Sequencing), a fast, streamlined, Tn5 tagmentation-based assay for measuring the genome-wide activity of Cas9 in vitro that is easily scalable to many targets and samples. In this study, we directly compare CIRCLE-seq to CHANGE-seq and systematically evaluate Cas9 genome-wide activity on 110 targets across 13 therapeutically-relevant loci leveraging CHANGE-seq. We validate the sensitivity of CHANGE-seq for identifying sites of bona fide cellular off-target mutations using GUIDE-seq and sensitive targeted tag sequencing. Additionally, we sought to evaluate the impact of chromatin accessibility on cellular off-target activity by comparing CHANGE-seq with matched GUIDE-seq cellular off-target, chromatin, and transcriptional profiles generated from the same human primary T-cells.
2020-06-15 | GSE149295 | GEO
Project description:In this study, we combine MspJI digestion and electrophoretic band selection with next generation high-throughput sequencing technology to detect 5-methylcytosines in Arabidopsis genome. By developing a bioinformatics workflow to attribute the CNNR sites recognized by MspJI to the reference genome, we fulfilled the systematic assessment of this method. According to the assessment, here we provide the method for generating a detailed map of plant methylome that could be feasible, reliable and economical in methylation investigation. Extracting the MspJI digested fragments, constructing sequencing library according to the Illumina protocol and sequencing with Illumina HiSeq2000. Repeatability and reproducibility studies were performed between two samples from the same individual. Specificity and sensitivity of the method was examined by comparing our data with WGBS data downloaded from GEO (GSE15922: GSM399600). **The WGBS seq data ('aerial_tissues_BS_seq_CNNR.gff') was generated from the GSM399600 Sample supplementary files ('aerial_tissues_BS_seq_alignment_batch-*.gff.gz') and was utilized to do comparative study with our MspJI-seq data including sensitivity and specificity analysis.
2013-05-01 | E-GEOD-46428 | biostudies-arrayexpress
Project description:Next-generation sequencing has been widely used for the genome-wide profiling of histone modifications, transcription factor binding and gene expression through chromatin immunoprecipitated DNA sequencing (ChIP-seq) and cDNA sequencing (RNA-seq). Here, we describe a versatile library construction method that can be applied to both ChIP-seq and RNA-seq on the widely used Illumina platforms. Standard methods for ChIP-seq library construction require nanograms of starting DNA, substantially limiting its application to rare cell types or limited clinical samples. By minimizing the DNA purification steps that cause major sample loss, our method achieved a high sensitivity in ChIP-seq library preparation. Using this method, we achieved the following: (1) generated high-quality epigenomic and transcription factor-binding maps using ChIP-seq for murine adipocytes; (2) successfully prepared a ChIP-seq library from as little as 25 pg of starting DNA; (3) achieved paired-end sequencing of the ChIP-seq libraries; (4) systematically profiled gene expression dynamics during murine adipogenesis using RNA-seq; and (5) preserved the strand specificity of the transcripts in RNA-seq. Given its sensitivity and versatility in both double-stranded and single-stranded DNA library construction, this method has wide applications in genomic, epigenomic, transcriptomic and interactomic studies. Pre-adipocytes and mature adipocytes were collected. Their chromatin and RNA were subjected to ChIP and mRNA extraction. Sequencing libraries from ChIP DNA or mRNA were generated following either standard protocols or TELP method. The quality and features of TELP libraries were proved and demonstrated in comparison with standard libraries or other published data.
2015-12-15 | E-GEOD-75966 | biostudies-arrayexpress
Project description:We recently developed CHANGE-seq (Circularization for High-throughput Analysis of Nuclease Genome-wide Effects by Sequencing), a fast, streamlined, Tn5 tagmentation-based assay for measuring the genome-wide activity of Cas9 in vitro that is easily scalable to many targets and samples. In this study, we directly compare CIRCLE-seq to CHANGE-seq and systematically evaluate Cas9 genome-wide activity on 110 targets across 13 therapeutically-relevant loci leveraging CHANGE-seq. We validate the sensitivity of CHANGE-seq for identifying sites of bona fide cellular off-target mutations using GUIDE-seq and sensitive targeted tag sequencing. Additionally, we sought to evaluate the impact of chromatin accessibility on cellular off-target activity by comparing CHANGE-seq with matched GUIDE-seq cellular off-target, chromatin, and transcriptional profiles generated from the same human primary T-cells.
2020-09-22 | GSE149362 | GEO
Project description:We used our newly ultra deep sequence data and bioinformatics to re-annotate P. xylostella genome for high confidence miRNAs with the correct 5p and 3p arm features. Furthermore, the whole genome was screened to identify potential miRNA binding sites using three target-predicting algorithms. Totally, 203 mature miRNAs were annotated, including 33 novel miRNAs.
2016-08-01 | GSE76321 | GEO
Project description:RNA-guided genome editing with the CRISPR-Cas9 system has great potential for basic and clinical research, but the determinants of targeting specificity and the extent of off-target cleavage remain insufficiently understood. Using chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq), we mapped genome-wide binding sites of catalytically inactive Cas9 (dCas9) in HEK293T cells, in combination with 12 different single guide RNAs (sgRNAs). The number of off-target sites bound by dCas9 varied from ~10 to >1,000 depending on the sgRNA. Analysis of off-target binding sites showed the importance of the PAM-proximal region of the sgRNA guiding sequence and that dCas9 binding sites are enriched in open chromatin regions. When targeted with catalytically active Cas9, some off-target binding sites had indels above background levels in a region around the ChIP-seq peak, but generally at lower rates than the on-target sites. Our results elucidate major determinants of Cas9 targeting, and we show that ChIP-seq allows unbiased detection of Cas9 binding sites genome-wide 1.sgRNA1-6 binding sites were identified with ChipSeq by using HA antibody (there are 2 replicates for sgRNA1-3, one sample for sgRNA4-6,one control without sgRNA) 2.PCR products which amplifies " off-target genomic sites" were deep sequenced in the presence of WT Cas9+sgRNA or WT Cas9 alone( unique adaptor was used for each sgRNA and mixed for multiplex run)
2014-05-18 | E-GEOD-55887 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:To interrogate single-base resolution 6mA sites in the genome-wide, we develop DA-6mA-seq (DpnI-Assisted N6-methylAdenine sequencing), an optimized sequencing method taking advantage of restriction enzyme DpnI, which exclusively cleaves methylated adenine sites. We find DpnI also recognizes other sequence motifs besides the canonical GATC restriction sites, largely expanding the application range of this method. DA-6mA-seq requires less starting material and lower sequencing depth than previous methods, but achieves higher sensitivity, providing a good strategy to identify 6mA in large genome with a low abundance of 6mA. We rebuild the 6mA maps of Chlamydomonas by DA-6mA-seq and then apply this method to another two eukaryotic organisms, Plasmodium and Penicillium. Further analysis reveals most 6mA sites are symmetric at various sequence contexts, suggesting 6mA may function as a new heritable epigenetic mark in eukaryotes.
2016-04-12 | GSE74430 | GEO