Dataset Information

CHANGE-seq reveals the genome-wide activity of CRISPR-Cas9 [RNA-seq]

ABSTRACT: We recently developed CHANGE-seq (Circularization for High-throughput Analysis of Nuclease Genome-wide Effects by Sequencing), a fast, streamlined, Tn5 tagmentation-based assay for measuring the genome-wide activity of Cas9 in vitro that is easily scalable to many targets and samples. In this study, we directly compare CIRCLE-seq to CHANGE-seq and systematically evaluate Cas9 genome-wide activity on 110 targets across 13 therapeutically-relevant loci leveraging CHANGE-seq. We validate the sensitivity of CHANGE-seq for identifying sites of bona fide cellular off-target mutations using GUIDE-seq and sensitive targeted tag sequencing. Additionally, we sought to evaluate the impact of chromatin accessibility on cellular off-target activity by comparing CHANGE-seq with matched GUIDE-seq cellular off-target, chromatin, and transcriptional profiles generated from the same human primary T-cells.

ORGANISM(S): Homo sapiens

PROVIDER: GSE149362 | GEO | 2020/09/22

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

CHANGE-seq reveals the genome-wide activity of CRISPR-Cas9 [RNA-seq]

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets